Gene detail

Detailed information of XP_074623863.1 in Acropora palmata

Genomic Location: NC_133882.1:19290915...19301425
NR annotation: XP_027060191.1, anoctamin-8-like isoform X1 [Pocillopora damicornis]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074623863.1

ATGAAGAAAGCATGGGATTTTGCTAAGACCAAACAGTTCAACGCATGGAACTGGGCAAAGACAGCCGCCAAAGATGTTTTCAACAGTAATAAAGGCGAAGAAGGCAGTTTTGCAAAAGCCTCAAAATTTGTCTTGTCGTCCAAACTATGGGAACATTCCACACCGTCAAAGACATGCGATGTTTTGATCACATTTCCCAAAAAGACAGAGGACTACACTGTCATGTGGTTGTTGTCAAGACTACGGGCACGGGTACCAGATGTTGACGTTCACGTGCGACAAATGGCGCACTCGCCAGTTTACGGCTTCTATCTCAGTTCATCCTTTGAGGTGTTCTTACAACAAGCTGAAAATTTAGGATTGAAAAAGAAACTCAAAGGTGGTGGAATAACTGACTTTAAATACGATGAAAGAATGAGCTTCGAGGGTAGTGATGACCCCACGACGTTTTTCACTTCCGGCGAAAGACAGAGTATGATTCTGGAAATGGTCAACGATTTGAGAGCGGTACAAGGCGATGAGCTTGGCAAGATCAAGTTTGTGGAAGGACAGCAGATTGTGCCAAAGCTGTTATCCGACGGTGTGGTAGAAAAAATGTTTCCTCTTCATAATCACGATGACCTTGCCAAGCTAAGAAAGACCTGGGTCTCAGCGTTCTTCAAGAAACAACCACTTGATGACATTTGCCTGTATTTTGGCGTGAAAATCGCCATGTATTTTGCCTGGCTTGGTATGTACACCAAATGGTTGGTGGCGCCTGCAGTCTTGGGTATCGTTACCTTCATCCTTTCCTCCAGAAGCGAGGCAACGAGGGACTGGTGCATATTATTCTTCAACATCTTCAATATAGTGTGGGCTACACTGTTCTTGGAGGCTTGGAAGCGAAAGAGCGCTGAGCTTGCGTACAAATGGGGCACAATGGACATGCCATCTGATGTCTTGAAAGAGCCAAGACCGCTGTTTAGGGGTGAATATAAACCAAGTGAAATCACTGGACGAATAGAGCCACAGTTTCCTTCCTGGAAAAGAAACATCTTCCGCTACTGCGTCTCCTTGCCAGTCATCTTGACATCATTGGGCGTCGTTTGTCTGTCCATGTTGCTATGCTTTGAGTTTCAAAGGTGGGTGGATGGCATGGAGAACCCACCGAAGCCTCTCAAGTTTGCTCCAAAAATCGCCCTGGCTGTTTGCATTGGCCTTTTGGACGACAATTATAAGAAGGTTGCCTATCACTTGAACGACAAAGAAAACTATCGACTTCAAGAGACGTACGAAAATCATCTAATTATCAAACTGGTTTCGTTCCAATTCTTTAACGCCTTTTTGGCGCTTTTTTACATCGCCTTCTACATACAAGATATGAACAGACTGAAAAATCAACTGGCTGCACTTCTCATCACAAAACAAGTGGTGGGAAATGTCAAGGAAGCTTTAATTCCTTTCGTCAAACAAAAAGTGAAGGAATGGAAAATGAAAAAAGAAGAAGCCAAAGCAAAGAAAGAAAAGGACGAGAAAGGAGGCAAAGACAAGGCAGCTGGGAACGAGAAGTCAGATAAGCCAAAGGAACTGGATACACCCCTTATGAACCAGGCTGAGATTGAAAGCACCATGGCTGAGTACGAGGATACCTTTGAGGATTACCTGGAAATGTTCATTCAATTTGGATACGTGGTTCTCTTCTCATCTGCTTTTCCCCTTGCTGCTTTGTGTGCTTTGCTGAATAACATCATTGAGATCAGAAGTGATGCATTCAAGTTGTGCACCAACTTACGAAGACCATTCGGTGAAAGAGTTGAAAACATTGGAACTTGGCAGGATGCAATGGAGGTGATGGGCGTGGTCGCAGTAATGGTGAATCTCGCTCTGCTTGGTATGGGAGGCTCAGTTCAGCGGATGTTCCCAAACATGACAGTAACTGACAGAATAATTCTCATTGTTGTATTGGAGCATCTTGTCCTTGGAATCAAGTTCGCGGTGGCATATGCTATACCTGACATACCAGAATGGGTGGAGCATGAAATAGCCAAGATGGAGTTTCAAAGGCGACAGGCTCTGAAGAGCGCTCCAAGTACTCCGAAGTCTCCAATAAACCCACAAGACAAGGCTCACACACCAGTGTAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6PB70	Anoctamin-8 OS=Mus musculus OX=10090 GN=Ano8 PE=1 SV=3
Q9HCE9	Anoctamin-8 OS=Homo sapiens OX=9606 GN=ANO8 PE=1 SV=3
Q8BH79	Anoctamin-10 OS=Mus musculus OX=10090 GN=Ano10 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001986 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF04547 all species →	Anoctamin	Calcium-activated chloride channel	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR007632 all species →	Family	Anoctamin	Interproscan
IPR049452 all species →	Domain	Anoctamin, transmembrane domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12308 all species →	ANOCTAMIN	Interproscan

Gene Ontology

No Gene Ontology signature was detected for XP_074623863.1. This gene does have a gene model — the search simply returned no hit.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K19502	ANO8, TMEM16H; anoctamin-8	-	Ion channels	ko04040	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074623863.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

68TPM > 0

2Conditions

60.9Max TPM

16.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	36	10.66	23.31
all_coral_tissue · baseline	38	32	24.47	60.91

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.31
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.03
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.78
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.70
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.33
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.15
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.48
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.84
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.60
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.80
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.09
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.79
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.39
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.98
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.76
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.15
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.72
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.61
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.32
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.02
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.32
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.25
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.12
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.46
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.26
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.07
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.03
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.00
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.99
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.84
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.76
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.64
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.71
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.69
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.64
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.92
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	60.91
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	50.34
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	45.60
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	45.02
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	43.66
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	43.41
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	42.62
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	40.67
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	39.11
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.88
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.64
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.17
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.80
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.94
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.84
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.18
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.16
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.21
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.01
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.71
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.20
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.01
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.87
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.20
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.19
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.67
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.33
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.99
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.87
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.02
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.25
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.50
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.