Gene detail

Detailed information of XP_074623928.1 in Acropora palmata

Genomic Location: NC_133886.1:10420755...10438352
NR annotation: XP_015759101.1, PREDICTED: signal transducer and activator of transcription 5B-like isoform X1 [Acropora digitifera]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074623928.1

ATGTCTTGTTGGGAAACTTTTCAAGAACTAGAAGTGGGTCAAAGAAATAAAATTCTACTGGAGCTACAAGAAATTTATGGCGGCTCATTTGAATTTGACGCGACCATTTACTTGATGCAGTGGTTAGAACAACAGGCTTGGGAAGATGCAATGAAAAGCAACATTGAGGGTACTAATATTATAAAAGCCAAGCAGCTAATGGATGATGTCATTGTCCAACTGAATGAACAAAAAAAGAAGTTGGAGAATTTTGCATCAATTGCTGTCAGTGATATACATAATGTGTTGATGGCCAAAAAAATTCAAGAAGTGATTCAACAACTTGAGGCAAAGTATGGCAATGACCCAGTTAAGCTTTATGAGTATTTTTATGGAGTTGTCATCAAACTAAGGGAACTAGTTCAAGTTGCCACAAATATTCCTGATGGAATGACAACTCTTGATTCAGATGATATGGAATTGGAAGAGAGTGTTCCTCCAGATCCCCATGCAGAACTCAGAAAGCAGCTTGAGGAACTTGTCAAGGACAGCCAGAAACATGATGTCCTTCTCAAAGAAATTGAGCAATTGAAGGAGCAGTATGTGATCAAATTTCAGGAGGTCACTGCCAGGATAGCTCACATGGAGGCACAGAAAAACCAAATTACCAACATGTCAAATATGAATGAAAAGGATAAGAAACAAAGATTAGAAAAATTAAAGGTGGAGTCAGAGAAACTACAGCAGCAGCTAAGCAGACTGGGAGAGGAGTTGTCAATTGCGAAGCGATTGGGCTTCATTGAGTGCCTTTGTAATCACCTTAAAAAGCTGTCAGAAATAGAGAAATCTATTTTTGAAGAAATTGCAGAGTGGAAGCATCTGCAGCAAAGATCATTGTGTGGATATCCGTGTCCTCCACCACTTGACAAACTTCAAGAAATCTGTGAAACACTTGCCGAACTCCTTTGGAAACTCTTTCAGCAGGCCTCACAGCTTGATAACTTGTTTCATCAAGCATTTCAAGGAAATGAAGTGGAACTTAAAAGGATGGAGAATGTTAAAACATCTGCAAGAAACCTCCTGCAATGGTTCCTCGTCAAGACTTTCATCATAGAAAGACAGCCTCCGCAAGTGTTAAAGAAGGAGACAAAGTTTGGAACTGTCGTGAGGCACCTACTGGGTGACAAGCTTAATATCCCGATCAACCCTCCTGAAGTCAGTGTCTCCCTCATTTCAGAAAAGCAAGCCCAATCCCTTCATAGTGGAGGTCGTAACAAAAGCAATGGGACACCCAGCTCAAACCCTGTGCTAAACTGTAAAAAGACACTAGAGTTTAATCAAGTGACGCGTAAACTGGTTGCAGAGTTTAAGAACTTGTCATTGACGAAGGCCACAAGACAAGGTGGCAAAAATAAAGAGGCGGTAACGGAGGAGAAATCCGCGCTGTACTTCACCTCGCAAATCACCCTGGGAAAGGAACAGTTTAATATCTTTGTGATGTCAGTGCCAGTAGTTGTGACAGTTCATGGTAACCAGCAATGTGATGCTGAAGCGACTGTTTTCTGGGAAAATGCTTTTTCTGAAAAGGAAAGGAAACCCTTCGATGTTCCTGATCAGATTGAGTGGCCCCGCTTTTCTGATGCCCTGAACAAGAGATGGACACTAAGCAATGGACGTGAACTGAGTCTTGATTGTATCACCTACCTGGGAGCTAAACTTTTCCCAGGAAAACTCGAGGGAGGAATGGACAGCGCCTTAGTTACAAAGCAAATGTTGAATCGGGATCACATAAACGGCCGTACATTCTCTTTTTGGAAGTGGTTCTACGGCGCACTGGACGTAGTTTGCAAGCGGCTAGTGGACGAATGGAGAGATGGACACGTGGCTGGATTTGTGAGCAAAGTCGACGCTCATAAAGTTTTGGAAAGCTGTACACCGGGAACGTTCATGCTACGATTTAGTGACAGTGAGCTGGGCGGAGTTAGTGTAGCTTATGTTCAACTTATGGAGAATGGTCCATGTGAAGTTGTTGATGTGGAGCCTTGGACAAACACCCACCTGCAAATGCGAAAGTTTTCTGACCGATTGAAGGATCTGGATGAGCTGATTTTCCTTTACCCAAGTATTCAGAAACATGTTGCTTTCGGTTCATACTACACTAATGATGATAATATTGCAGCTGAAGGAAGCTCTGGCTATCATCCCACCGTACTTGCCACCAGATTGGCCGGCCATATGGTTGGAAGAAGCCCCATGCATCCTGGATCTCAGGACTCTACCATGGAAACTCTGTCATCAAGTTCGTTTCCCATTAGCGGTTTTTCAGATATGTCGTTAGGTTTATACCCAGGCTCTCCCGCTTCACCAGCCTCGCCCCAGTCAGTCGTCTCAAGCGTTCTAGAAACTGAGCTTGGTTTGGGAAATCAGGAAATAGTGGGAGACTTCGGCCATCTGGCGCCTGATTTGGCTTTAAGTAGCGTGTTTCTGAGCGGTCTTAATCAAGGAGCAGATGGGGTATCTCCTGGACCTGCGAGTTATCTGTCTGCTATGGTGGCCGCCATGGGAGACGATCCCAGCTTTGCTGAAATTTTACTGTCCGAAGACCTGAATGCCACGCAGCCGTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P52632	Signal transducer and activator of transcription 5B OS=Rattus norvegicus OX=10116 GN=Stat5b PE=1 SV=1
P42232	Signal transducer and activator of transcription 5B OS=Mus musculus OX=10090 GN=Stat5b PE=1 SV=1
Q9TUZ0	Signal transducer and activator of transcription 5B OS=Sus scrofa OX=9823 GN=STAT5B PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003471 (this species only)
Transcription factor family	STAT · all TF in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02864 all species →	STAT_bind	STAT protein, DNA binding domain	Domain	Interproscan
PF21354 all species →	STAT_linker	Signal transducer and activator of transcription, linker domain	Domain	Interproscan
PF02865 all species →	STAT_int	STAT protein, protein interaction domain	Domain	Interproscan
PF01017 all species →	STAT_alpha	STAT protein, all-alpha domain	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001217 all species →	Family	Transcription factor STAT	Interproscan
IPR015988 all species →	Homologous_superfamily	STAT transcription factor, coiled coil	Interproscan
IPR036535 all species →	Homologous_superfamily	STAT transcription factor, N-terminal domain superfamily	Interproscan
IPR008967 all species →	Homologous_superfamily	p53-like transcription factor, DNA-binding domain superfamily	Interproscan
IPR013799 all species →	Domain	STAT transcription factor, protein interaction	Interproscan
IPR013801 all species →	Domain	STAT transcription factor, DNA-binding	Interproscan
IPR036860 all species →	Homologous_superfamily	SH2 domain superfamily	Interproscan
IPR048988 all species →	Domain	Signal transducer and activator of transcription, linker domain	Interproscan
IPR012345 all species →	Homologous_superfamily	STAT transcription factor, DNA-binding, N-terminal	Interproscan
IPR000980 all species →	Domain	SH2 domain	Interproscan
IPR013800 all species →	Domain	STAT transcription factor, all-alpha domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11801 all species →	SIGNAL TRANSDUCER AND ACTIVATOR OF TRANSCRIPTION	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000978 all species →	Molecular Function	RNA polymerase II cis-regulatory region sequence-specific DNA binding	Interproscan
GO:0000981 all species →	Molecular Function	DNA-binding transcription factor activity, RNA polymerase II-specific	Interproscan
GO:0003700 all species →	Molecular Function	DNA-binding transcription factor activity	Interproscan
GO:0006355 all species →	Biological Process	regulation of DNA-templated transcription	Interproscan
GO:0006357 all species →	Biological Process	regulation of transcription by RNA polymerase II	Interproscan
GO:0006952 all species →	Biological Process	defense response	Interproscan
GO:0007165 all species →	Biological Process	signal transduction	Interproscan
GO:0007259 all species →	Biological Process	cell surface receptor signaling pathway via JAK-STAT	Interproscan
GO:0042127 all species →	Biological Process	regulation of cell population proliferation	Interproscan
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K11224	STAT5B; signal transducer and activator of transcription 5B	-	Transcription factors	ko03000	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074623928.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

75TPM > 0

2Conditions

113.4Max TPM

39.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	40	34.46	84.02
all_coral_tissue · baseline	38	35	45.52	113.43

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	84.02
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	83.86
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	81.83
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	78.13
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	59.32
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	52.86
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	51.15
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	50.34
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	50.06
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	47.94
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	47.14
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	46.44
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	44.33
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	43.62
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	42.46
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	41.12
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	40.82
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	40.81
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	37.15
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	36.67
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	36.05
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	34.10
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.51
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.70
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.47
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.42
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.47
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.60
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.74
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.62
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.45
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.22
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.17
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.62
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.56
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.24
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.75
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.77
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.30
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.43
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	113.43
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	95.40
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	91.00
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	90.40
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	89.37
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	70.00
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	54.88
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	54.49
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	53.97
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	53.90
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	53.12
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	50.44
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	50.34
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	49.62
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	49.46
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	46.35
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	44.46
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	44.31
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	44.26
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	44.17
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	43.88
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	43.83
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	39.81
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	38.17
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	37.27
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.65
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.80
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.70
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.36
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.80
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.77
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.39
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.39
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.67
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.90
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.