Gene detail

Detailed information of XP_074623971.1 in Acropora palmata

Genomic Location: NC_133886.1:1291636...1307849
NR annotation: XP_029190535.2, general transcription and DNA repair factor IIH helicase subunit XPB-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074623971.1

ATGAAAGGCCTAAAACGCAGAAACGATGATTCCTCAAAGTCATCAAAAAAGTCAAAGAAAAGCAAGACAGAGGAAGAGGATGAATATGGTGAAGAGGAATACACAGATGATGTGGAAGTTGCTCCTAAGTCATCGTCTGCTACCGTTACAGATCAAGCAAATGAAGATGAGTTTGGAGCCAAAGATTATCGCAAGCTGATTGATTTGAAAGCAGACCATTCCTCCAGACCCCTCTGGGTGGCGCCTGACGGCCACATTTTCTTGGAGTCTTTTTCTCCAGTGTATAAACATGCTCATGACTTTCTCATAGCTATTTCAGAGCCTGTTTGTAGACCAGAACATATCCACGAGTATAGGTTGACAGCTTATTCTCTTTATGCTGCTGTGTCAGTTGGCCTTCAGACAAGTGATATCATTGAATATTTGCGACGCTTAAGCAAGACCACAATTCCTGATGGAATAATCCAATTTATTAAGATTTGCACTCTTAGCTATGGCAAAGTGAAACTTGTCTTGAAACACAACAGATACTTTGTGGAGAGCAACTTTCCAGAGGTTCTACAGCATCTACTGCAAGATTCAGCAATTGAGCATTGCCGCACAAGAACAGTTGACGACTTTCAGAATGAGTTGAGGGAAGATCAACTGATTAAGTCCTCTGTTGGTGGAAAGGCCTCCCTAAAGCTGAACAAACCACAACCGGAGTCAAATGGTAATTCTTCCCATGCAAATGAACAGGAACAGTCTTCAGAAGCACCATCTATTCCTACGGATATCACTGATTACATTGAAAAAATAGATCAGGATGAGGATGAAGAAGAGAGTCAAACCTATTCCTTTGAGGTGGCTCAGGAACACATAGAAACTTTACAAAGGAAGTGCATTGAGTTGGATTATCCCTTGCTCGCTGAGTATGATTTCAAGAATGATGCTGTAAACCCTGATCTGAACATTGACTTAAAGCCAACTACAGTTTTGCGGCCTTACCAGGAAAAAAGTCTTCGCAAGATGTTTGGTAATGGTCGTGCAAGATCTGGTGTTATTGTGCTTCCATGTGGTGCGGGTAAGACTCTGGTTGGTGTGACAGCAGCTTGTACAGTCAGGAAGCGATGCCTGGTGCTTTGTACATCTGGTGTTGCTGTTGAACAATGGAAGAGTCAGTTCAAGATGTGGTCAACAATTGATGATCGTACAATCTGCCGCTTCACGTCAGATGCCAAAGATAAACCCGTCAACTGCAATATTGCTATTTCAACGTATTCCATGGTATCTTTCACCGGAAAAAGATCTTGGGAAGCCGGCGAGGTGATGAATTTCATGCAGACGCAGGAATGGGGATTGATGATATTAGATGAGGTTCATACAATACCAGCTAAACAATTTAGAAGAGTGTTAACAGTTGTCCAAGCACATTGCAAGTTGGGACTTACAGCGACGCTGGTCCGTGAGGATGACAAAATCCAGGACCTTAATTTCCTCATCGGACCCAAACTTTACGAAGCCAATTGGATGGAACTACAAAACAATGGATTTATTGCACGTGTCCAGTGCGCAGAGGTTTGGTGCCCAATGACGCCAGAGTTTTACCGAGAATATCTGAACATCAGAACACGGAAAAGGAAGTTGTTGTATGTCATGAACCCAAATAAGTTCAGATCTTGTGAGTTTTTGATTCGCTACCATGAAAGGCGGAATGACAAAGTCATCGTATTTTCTGACAATGTGTTTGCTCTTAAAAAGTATGCTGAGAAGTTAAAGAAGCCTTTTATCTATGGTCCAACGTCGCAAGGTGAACGAATGCAAATTCTGCAGAATTTTCAGCACAACCCACTCGTCAACACAATATTTATCTCCAAGGTTGGAGATAACTCATTTGATCTTCCAGAGGCCAATGTTCTGATTCAGGTCTCTTCGCACGGCGGATCAAGAAGACAGGAAGCTCAGCGACTTGGACGAATTCTACGAGCGAAGAAAGATATGGCTGCTGAGGAATACAACGCATTTTTTTACACACTTGTTTCAACGGATACTGAAGAAATGTACTATTCTGCGAAACGTCAACGGTTTTTGGTTAATCAAGGTTATAGCTTCAAGGTTATTACAAGACTGGCCGGAATGGAGGAGGAGAACTTAGAACTTGGAGACAAGAGAAAGCAGCAGGAACTTCTTCAGCAGGTTCTTGCTGCCAGCGATGCGGACGCTGAAGAAGAGAGAGTAGCGTCAGATTCTATGAACCGCAGCAGCTCATCGACATCTATCGTTTCCCGTCGCCAAGGTTCCATGGCATCCATGTCTGGAGCAGACGATATGATGTATTTGGAATACAGAAGCAGTAACAAACAATCCAAGAGTCGACATCCTCTCTTCAAACAATTCAGAAAATAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q1RMT1	General transcription and DNA repair factor IIH helicase/translocase subunit XPB OS=Bos taurus OX=9913 GN=ERCC3 PE=2 SV=1
Q60HG1	General transcription and DNA repair factor IIH helicase/translocase subunit XPB OS=Macaca fascicularis OX=9541 GN=ERCC3 PE=2 SV=1
P19447	General transcription and DNA repair factor IIH helicase/translocase subunit XPB OS=Homo sapiens OX=9606 GN=ERCC3 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004047 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13625 all species →	Helicase_C_3	Helicase conserved C-terminal domain	Domain	Interproscan
PF16203 all species →	ERCC3_RAD25_C	ERCC3/RAD25/XPB C-terminal helicase	Domain	Interproscan
PF04851 all species →	ResIII	Type III restriction enzyme, res subunit	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001161 all species →	Family	Helicase XPB/Ssl2	Interproscan
IPR032830 all species →	Domain	Helicase XPB/Ssl2, N-terminal domain	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR014001 all species →	Domain	Helicase superfamily 1/2, ATP-binding domain	Interproscan
IPR001650 all species →	Domain	Helicase, C-terminal domain-like	Interproscan
IPR050615 all species →	Family	ATP-dependent DNA Helicase	Interproscan
IPR032438 all species →	Domain	ERCC3/RAD25/XPB helicase, C-terminal domain	Interproscan
IPR006935 all species →	Domain	Helicase/UvrB, N-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11274 all species →	RAD25/XP-B DNA REPAIR HELICASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003678 all species →	Molecular Function	DNA helicase activity	Interproscan
GO:0006289 all species →	Biological Process	nucleotide-excision repair	Interproscan
GO:0006367 all species →	Biological Process	transcription initiation at RNA polymerase II promoter	Interproscan
GO:0000112 all species →	Cellular Component	nucleotide-excision repair factor 3 complex	Interproscan
GO:0005675 all species →	Cellular Component	transcription factor TFIIH holo complex	Interproscan
GO:0043138 all species →	Molecular Function	3'-5' DNA helicase activity	Interproscan
GO:0097550 all species →	Cellular Component	transcription preinitiation complex	Interproscan
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0016787 all species →	Molecular Function	hydrolase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K10843	ERCC3, XPB; DNA excision repair protein ERCC-3	EC:5.6.2.4	DNA repair and recombination proteins	ko03400	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074623971.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

71TPM > 0

2Conditions

64.3Max TPM

27.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	40	26.85	64.33
all_coral_tissue · baseline	38	31	28.00	42.61

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	64.33
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	54.61
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	40.77
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	37.47
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.32
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	34.87
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	34.79
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	34.48
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	34.41
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	34.29
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	34.22
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.34
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.15
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.96
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.67
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.47
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.37
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.07
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.83
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.28
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.27
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.67
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.21
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.96
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.05
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.39
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.93
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.66
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.25
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.92
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.67
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.43
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.15
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.77
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.74
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.21
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.88
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.11
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.06
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.89
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	42.61
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	41.07
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	40.24
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	39.82
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	39.15
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	38.11
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	37.76
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	37.46
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	37.12
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.77
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.45
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.14
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.14
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.05
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.75
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.74
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.36
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.08
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.66
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.27
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.26
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.80
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.78
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.63
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.84
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.22
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.99
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.82
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.19
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.81
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.82
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.