Gene detail

Detailed information of XP_074624263.1 in Acropora palmata

Genomic Location: NC_133886.1:3704172...3716907
NR annotation: XP_029200423.2, methylmalonyl-CoA mutase, mitochondrial-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074624263.1

ATGTTGACCAGTTCCAAGATCAAAAGCAAATTTCTGCTTACACCATTGTCAGTAGTATGTCAGTTTGCTGGGAAACGTTTCCTTCAAAGAGAGCCTTTGCATCCAGAGTGGACCGAACTGGCAAAGAAACAACTAAAAGGTGCTGATCCTGAGAAGAAATTAACATGGCACACACCAGAGGGCATAGACATCAAACCAATTTATACCAACATAGACACTAAACTTGCAGAAGAAGAAATTCCAGGAAAATTCCCTTTTACACGAGGGCCTTACCCAACCATGTACACAAACCGTCCCTGGACAATCAGACAGTATGCAGGTTTTAGCACTGTTGAAGAAAGCAACAAGTTTTACCGTGACAATATCAAGGCAGGTCAGCAGGGTCTCAGTGTGGCGTTTGACTTGGCCACACATAGAGGATATGACTCAGATAACCCGAGAGTCCATGGTGATGTTGGAATGGCTGGTGTGGCAGTTGATTCTGTTGAAGATATGAAGATGTTATTTGATGGCATACCATTGGATAAGATGTCTGTTTCCATGACGATGAATGGTGCTGTTTTACCAGTATTAGCCATGTACATTGTGGCCGCAGAAGAACAAGGAGTCAAGCAAGACCAGTTATCAGGGACAATTCAGAATGACATCTTGAAGGAATTTATGGTTCGCAACACATACATCTTCCCTCCTGAGCCTTCCATGAAGCTGATCGGTGATATCTTCTCCTACACTTCACAGAATATGCCCAAGTACAACAGTATTTCCATCTCTGGTTACCACATGCAAGAGGCAGGTGCTGATACTGTGCTGGAAATGGCTTTCACTTTAGCTGATGGCTTGGAGTACTGCAGAACTGGACTTAAGGCAGGGCTGAACATTGACAACTTTGCACCAAGGCTTTCCTTTTTCTGGGGAATTGGGATGAATTTCTACATGGAAATTGCCAAAATGAGAGCTGCACGCAGATTATGGGCCGACCAGATAAAAGAACATTTTAACCCCAAAAATATGAAGTCGTGTATGTTGAGAACACATTCGCAGACGTCAGGCTGGTCCCTCACCGAACAGGATCCATACAACAATATCATCCGTACCACAATCGAGGCTATGGCTGCAGTCTTTGGTGGAACTCAGTCCCTTCACACTAACTCATTCGATGAGGCCCTGGCACTACCGACTCCATTCAGCGCGAGGATTGCTCGTAACACCCAGATAATACTGCAAGAAGAGTCAGGAATTCCAAATGTTGCAGATCCTTGGGGTGGCTCATTCATGATGGAATGTCTGACAAATGAGATTTACAAAAAAGGACTGGAAGTTATCAACGAGGTGGAAGACCTTGGGGGTATGGCCAAGGCTGTGGCTGCTGGAATGCCAAAACTGCGAATAGAAGAGTGTGCCGCCAAACGACAAGCTCGGATTGACTCTGGGTCAGAAACGATCGTCGGTGTTAACAAATATCGCTTGGAAAAAGAAGAAGCTATTGAAGTGCTTGTGGTGGATAACACCAAAGTCAGAGAGCAGCAGTTAGAAAAGTTGAAACGAATCAAAGAGCAGAGAAATCCGGACGAGGTGAAAATTGCGATGGATGCCATTTCTGAATGCTGTAAAACAGGACAAGGAAATCTGTTGGATCTTTCTATCAAGGCGGCAAGAGTTCGCTGCACAGTGGGTGAAATCACTGAGGCAATGGAAAGGATTGTCGGAAGGCATGTCGCCAGCGATCGCATGGTCAGCGGTGCATACAAAACGGAGTTCGGTGAAACTGATGAAATCAGCCAGTGTATAAAAAAAGTTGAGGCCTTTGTAGAGGTGGAAGGTCGCCGTCCTCGAATACTGGTGGCTAAAATGGGTCAAGATGGACACGACCGAGGCGCGAAAGTTATCGCAACTGGTTTCGCTGATCTCGGTTTTGATGTCGATATTGGGCCTCTTTTCCAGACCCCCAAAGAAGTTGCACAGCAAGCGGTGGACGCTGATGTGCATGTGGTTGGAATTAGTTCCCAGGCCGCTGGTCATAAAACGCTCCTACCAGAGCTCATAGCCCAGATGAAAGATATGGGAAGAGGAGATATCGTTGTTGTCTGTGGTGGAGTAATTCCACCGCAAGATTATGAATTTCTGTACAAAGCTGGAGTCAATGCAGTATTTGGACCTGGGACTCGGATCCCAGCTGCTGCAATGGATGTATTAGATGCAATTTTGAATGCAAATTCCGATCAAAAGACCACAGCTTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P22033	Methylmalonyl-CoA mutase, mitochondrial OS=Homo sapiens OX=9606 GN=MMUT PE=1 SV=4
P16332	Methylmalonyl-CoA mutase, mitochondrial OS=Mus musculus OX=10090 GN=Mmut PE=1 SV=2
Q5RFN2	Methylmalonyl-CoA mutase, mitochondrial OS=Pongo abelii OX=9601 GN=MMUT PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004409 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02310 all species →	B12-binding	B12 binding domain	Domain	Interproscan
PF01642 all species →	MM_CoA_mutase	Methylmalonyl-CoA mutase	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036724 all species →	Homologous_superfamily	Cobalamin-binding domain superfamily	Interproscan
IPR006099 all species →	Domain	Methylmalonyl-CoA mutase, alpha/beta chain, catalytic	Interproscan
IPR016176 all species →	Homologous_superfamily	Cobalamin (vitamin B12)-dependent enzyme, catalytic	Interproscan
IPR006158 all species →	Domain	Cobalamin (vitamin B12)-binding domain	Interproscan
IPR006098 all species →	Domain	Methylmalonyl-CoA mutase, alpha chain, catalytic	Interproscan
IPR006159 all species →	Domain	Methylmalonyl-CoA mutase, C-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR48101 all species →	METHYLMALONYL-COA MUTASE, MITOCHONDRIAL-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0031419 all species →	Molecular Function	cobalamin binding	Interproscan
GO:0046872 all species →	Molecular Function	metal ion binding	Interproscan
GO:0016866 all species →	Molecular Function	intramolecular transferase activity	Interproscan
GO:0003824 all species →	Molecular Function	catalytic activity	Interproscan
GO:0004494 all species →	Molecular Function	methylmalonyl-CoA mutase activity	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0005739 all species →	Cellular Component	mitochondrion	Interproscan
GO:0019678 all species →	Biological Process	propionate metabolic process, methylmalonyl pathway	Interproscan
GO:0016853 all species →	Molecular Function	isomerase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01847	MUT; methylmalonyl-CoA mutase	EC:5.4.99.2	Cobalamin transport and metabolism	ko04980	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074624263.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

69TPM > 0

2Conditions

82.1Max TPM

19.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	37	20.54	82.07
all_coral_tissue · baseline	38	32	18.22	30.93

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	82.07
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	71.01
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	43.02
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.83
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.69
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.83
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.81
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.19
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.93
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.03
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.54
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.93
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.33
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.63
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.38
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.86
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.84
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.84
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.81
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.35
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.14
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.74
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.82
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.64
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.36
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.93
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.84
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.19
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.76
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.32
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.52
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.73
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.81
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.32
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.81
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.05
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.82
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.93
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.47
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.29
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.26
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.13
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.08
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.16
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.82
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.73
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.35
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.27
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.07
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.96
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.69
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.26
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.74
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.45
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.36
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.34
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.05
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.58
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.28
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.61
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.56
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.08
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.72
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.98
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.21
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.42
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.07
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.49
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.86
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.