Gene detail

Detailed information of XP_074624604.1 in Acropora palmata

Genomic Location: NC_133886.1:1483801...1497962
NR annotation: XP_029190565.2, uncharacterized protein LOC114957329 isoform X2 [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074624604.1

ATGAAGTGGAGGCACTTCATACGACGTGTTTCAGATGGAGTTGATTTGTGGCAAAAGTGCTTGGACCAGGACCACCTAGATTCACATAGAGAACTTGTTGAAAGCGATAAATATGAAACCTATTTTGCAAGATTCAAGTCAGATTTTCAGAGTAGTACCATTTCAGTAACAAGGTTACCCAACAAAGTGACTTTAACTATTGGCACAAGGTTTCCATTGTTCAGCTTTGACTTATATGAAGTAAAGGATATTGAAAATAAAACAGAACTACAAAGAATCCTCTTCAGATTAGCTGATAGGGTCTCAGAACTCACTGACCAGTTGAAAGTACTATCGGATTCCTTGGAGAAAGTGAAGAACCAAAAGGATGGGGGTACAAGTGGATCATCAATATTTGATATCCCACTTAAGAAGTCCAACCAACCTCTACCTGCCAAACGCAAACAAGGCCACAGTCTCATTAATCCTGGAAGTAGAAAAGAAGCTGAGGTGGGTGTGGCAGATGGGGACAACACAGAGAACAATGTACACATCTCAGTCCTGGGAACTGATCAAACGCTTGATATATTCAAATGTACCAACCCAGCTTGTGAGCACTTTTGTACAAAGACCAACAAGAGGTACCACTGTCCACTGTGTAATAACAAGCCTCAGAAACCAGGGCGTATGAGGAGACACTTTGAAAAAATGCATGCGGGGAAGCAGATTGTATTGCATGGAGGTTACCAAATGCTCCGCTGTAAGCTTCGATGCACCAAAGCAAATGGTCGCATAACAGACAACTCGCATTATCACTGCTGCCTCTGTGGACGAGTGCTTGTTAGAAAGGTTCATCTTTATTGTCACCTTCAAGCTCACGCCGTGGGAAGCATGCGTGAAATTGACAAGATGTTAGATACAAAAGAAGATGCAGAGGAAGAGCCTTTGGAAGATTCTGAAATGGATGATGATGACGAAGATGAGGGTGATGTTAATGACCCCACTTTGGACTCTTCACAGATTTCAAGATTAGAAAGCTCAGAGCAAGATAATATTGTGGCTTTATCTGATGGGACGCAGGTTGTATTTGTCCAGTCTCTTCAGAACAGTGAGACACTTACAGTTGTGCCGTTTGATGAGCAATCAAACAGTCCAGCCATGAGCCAACCAGTTGAACACCACTGTATTGACTCAGGCAATGTCGTTGATTCCTCCAGTGATGTAACTGCTGGACTGCAAGTGCTGTCTTCAGGTTCATCCAGTCTAGATTCTGTACAACAGGAATTACAGCAAGAGTTGACAGTCAAGCAAGTAGAGGCTATGTTAAATCAAGGTGTGCAGAATAGCAAGGATGCTTCTTTGGGAATACAATCTTCAGTGAGTAATCTTCCAGATTGTGGTGAAGGTGCAGACACTGGCAATATAGACACTTTCACCACCAAGGGATCATTTGATGATAGCATGGAAACAGATGACAATGGCTTAGAAAACAGTCTCTCAAAACAGGTGCAAGATGAGGCTACATGTATGGAATTTGAGCCATGCTTACAGGTTGCAAATCTTCAGATGTCTACAACCACCAGTAAGGACATCACTGACCGTAGCACAGCGGATGTCGAAAGTTTAGGACAAAGTAACATCCAATTTGGGCAAGCTGTTTCTAGCCAAGCTGAATCCAAGTTTATCACATCAACCCCTGGTGGTGCCACTCAGACATCACAATTGGGGCAGTTAAGAACAGATCAAGGTTCATCTAAACTGATCATGATGAATCCAATAAGCAAACCATTATTTGATGAAGAGTCTTCCAATTTAAAAACTCAGACACCAAAAGCAAAACCAGTGCGTCAGGATTCCCTGACATTAGTTGATTCAGCTTTGTCTCCAAAGGAAGACGATCAAGTCTTCAAGGTTCTGCTTAACAACTTGTCCCCTGCCTCAAGTTGCTTCAGTCATCCATCAGTTCTGAACGCCAAGGATAACTTGGATGTTCGTAGATGCAGGAACACCTTTTGTGATTGTAGGTTATATCACTGTCCTCTATGTACGTGCTTACCAAACAAACCTGGCAGGATCAGAGAACACTTTAAAAAAATTCATGGCCAAGATCTTATCGTCAGATATCAAGGCTTTCATATGTTACGTTGCAAACTTGGCTGCTCCCGTCCAAGTGGAACCAAGGTCCTCAACTCTCATTATCATTGTTGCATTTGTGGGGCAATCTGCATCCGCAAATCCGGTGTTTATGAACATATGCGCATTAACCACTCTTGCGAGTCTTTAAAGAAAAACAGCCTGACAAGCTTACCACAAGAAGAAAAAGAGGTCAAGAATGATTCAATACCCAAACCTTTGGTTGTGCAAGTCCCCTTGGTTCATGCAGGAACCTCAGGGTCTGGGAGCCAACAGGTGGCTCAACCCCAGGCCCTACCTAGCCAAGGGATGGTTCCAGTAAGCTCCACCCAAAATACCGTTACAGTTCAGGTGCCGCAGCAAGGAAACAGCGAGAGTCAAGGTCAGCAACAGGTTGTCATTCTTATGCCGCAGCAATTAAATCAAACACAAGTTCAGTCGACAGGTCAGGCTCAACAACCCATTGTTATAGTCATGCCACAGACCGGAGGAGCACAAGTAGCACAGCCTATTGTTGTTCCCTTTCCTCAGATGTCAAACAACTAG

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004671 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF15384 all species →	PAXX	PAXX, PAralog of XRCC4 and XLF, also called C9orf142	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR027873 all species →	Family	Protein PAXX	Interproscan
IPR013087 all species →	Domain	Zinc finger C2H2-type	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR28586 all species →	PROTEIN PAXX	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006303 all species →	Biological Process	double-strand break repair via nonhomologous end joining	Interproscan
GO:0035861 all species →	Cellular Component	site of double-strand break	Interproscan
GO:0060090 all species →	Molecular Function	molecular adaptor activity	Interproscan
GO:0070419 all species →	Cellular Component	nonhomologous end joining complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for XP_074624604.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074624604.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

44TPM > 0

2Conditions

14.2Max TPM

4.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	22	4.11	14.19
all_coral_tissue · baseline	38	22	5.55	12.64

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.19
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.60
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.40
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.24
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.81
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.51
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.47
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.14
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.13
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.68
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.55
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.38
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.25
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.19
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.85
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.53
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.51
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.77
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.92
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.20
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.03
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.50
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.64
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.31
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.27
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.67
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.24
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.22
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.09
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.98
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.72
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.70
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.57
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.57
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.54
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.48
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.42
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.72
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.67
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.23
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.84
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.57
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.56
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1.73
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.