Gene detail

Detailed information of XP_074625962.1 in Acropora palmata

Genomic Location: NC_133887.1:6654193...6670515
NR annotation: XP_029201075.2, polycomb protein Scm-like isoform X1 [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074625962.1

ATGTCGGGAATCAACGAAGCCGTACGGATACCTGACAAACAGGATGGAGAAAGACTCAGCGAAGAAATGAAGGACTATGCCAAAAGTACTATGAATGAGTTGCTGGGGATGTTTGGTTATGGGGAAGAGATCACTCGCGAGGCTGTAGAGGAGCTACAAATTAAGCTGTTGCCAGAAGCTGATGAAAACATACAGCAAATGGGAAGCGAACCTTTACAAATGGAGAAAGATGTCTCTATTACAGGGGAGAATCAAGTTCTTGTGCAAATTCCTGGTGTACAAAATAACAACAGTTTAGGATTAGAACCTGTGCCAGAATTGGATAATGCAGTTACTGTTGTTCGTCGTGGCACACAGAATCTTGTAAACATTCCAAGTGAAACCATCAAGGAAGAACATGCTCTGGAAAAGGCGACAAATAAAGCTGCCAGTACCTCAGACTTGGGTGATAAAAAAGGTGTAGAGATAACATCGTCCACAGCTTTACCTGGAAAGCCCTCCAGGAACTGTTCATGGTGCAAGAAATCTGCTCCTTTGAAAGACATAACTTCCTGTGACGGTGAAAAGGTCATCTCTTGTAAAAATGTCTGCTCAGCTGAGTGTTTTGAGCAAACTGTCAAATTTATCAAGGAAAGTCAGAGTAATGAAGGCTCTTTGCAAGCTCAAAAGTTACCTGGATCAATCAAGACAGTCAAGCCTGGGCCATCCGTTCCAATAACACGACAAGCTTCGAAAGGACCACCAGCTGTTCTAAAATATCTCTTTTCTTGGGATGAATATCTGGCCAAGACAAATTCAGCTGCAGCTCCATGGAGTTTTTTCAAACAGTCGTCAACTCCTCCTTACAATGGCTTCCAAAAGAACATGAAACTAGAAGTGGCTGATCCAAGGATAGTGGACATCATGTGTGTAGCGACAGTGGTGGGTATCTTGGGACCAAGGATAAGATGTCGATTTGATGGTACAGATAGTGCTAACGATGTGTGGCATCTGGTGGATTCAAAGCAGATTCATCCCGTAGGGTGGTGTGAGGGCAACGGCGGACGGCTTCAACCCCCTGTTGGGTTCAAACTTGACCCCGGAAAGTACTCAACATTTCTTGCAAAAACACTGGCAAATGCTGAACTGGCTCCTGTGCGGCTATTTAAACGGGAACCAGCTCCTCCCAAGGGAAACCTCTTCAAGGTTGGGATGAAATTGGAAGCACTGGATCCTAAAAACCCGTTGCTCATCTGCGTGGCTACTGTTGCTGGCATCGATGGCGAGAAAATCCGCGTTGATTTTGATGGCTACCTCGGGTCCGATTACTGGTGCAGATACGATTCCCGGGATATATTTCCTGTTGGGTGGTGCCACTACAGCGGCCATCCTTTGCAACCACCAGGACAAACACGAAAAGCTTTGAAACAGTCGAACGTCAAGACAAAAGAACATCTGGAAAAACCTACCAAACCAGAAAAACCCGAAAAGCAAAATAAAAAGAAAATTCCAGAAATCTCTGCCGTGGCATCAGTTTGTGCAGCAACAGCTCCTGCCCCCACCCCAACAGTAACCACATCTTCAAATACTCGCAGGGAACCGCTGACACCTGACACAAGCGCCGACGCCTTGGGAACGAATCATACAGTTCAAGTGTTCATTAACCATTCATGTGTCCCAGGCCCTTTTCTTGATGTGGCAAAGGTGGCCTGCTTGCCAAGCTGCTTTCGAGGCACTGTCCCTAACGTAGCAAGAGATTGCTTTCAATCAATTGTGAACGCAGGCATTGAGCCCGCCAATGTCTTTAGAGTTTTTAAGCAGGGAAATGGAAAAACAAGGATAACATGCAAGAATGGGAAACAGACTTTGAGTTGCCATTTGCAAGTCATGGACAGGGTATCGCGATTTTGGAGTGTGTTGGATAAACTTACTGAGAATCTACAGTGTTGTGTTAACCTGTTCTCCGGGGAACGAATTGCTGGACTCTGCTCCAAATGCGGTAGAAACGCGTCAAGACGCAATACTGTTTTACCAGAAACGTTGCCCGTAGCTGCAAAGAAAAGTTCCACACCTATGGCTAAAAGAGGCGCGTATAAACAACGACAAGGAAGGGCTAAGCGTGCGCGGATTACCTATGACAAGGGGACACCTGATGACGCAGAAGCCAGTTCTCCAACAGTCGATTCAACATCTCCCCTCAAAACATGGTCTGTGGACGAGGTAGTAAAGTTTATGGAGAAATCTGAACTTGCAGAACATGCGGGGATGTTCAAAGAACACGAAATCGACGGCAAAGCTTTGCTTCTTTTAACCCGAGAGATGATCATGTCTTACATGGGACTCAAGCTTGGACCTGCCATCAAACTGTTGGACTGCATAGAGGAACTGAAAACCCAAAAATATACCTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8K214	Polycomb protein SCMH1 OS=Mus musculus OX=10090 GN=Scmh1 PE=1 SV=1
Q96GD3	Polycomb protein SCMH1 OS=Homo sapiens OX=9606 GN=SCMH1 PE=1 SV=1
Q9UQR0	Sex comb on midleg-like protein 2 OS=Homo sapiens OX=9606 GN=SCML2 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002745 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF12140 all species →	SLED	SLED domain	Domain	Interproscan
PF00536 all species →	SAM_1	SAM domain (Sterile alpha motif)	Domain	Interproscan
PF02820 all species →	MBT	mbt repeat	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR004092 all species →	Repeat	Mbt repeat	Interproscan
IPR001660 all species →	Domain	Sterile alpha motif domain	Interproscan
IPR013761 all species →	Homologous_superfamily	Sterile alpha motif/pointed domain superfamily	Interproscan
IPR050548 all species →	Family	Polycomb group and chromatin remodeling factors	Interproscan
IPR038348 all species →	Homologous_superfamily	SLED domain superfamily	Interproscan
IPR021987 all species →	Domain	SLED domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12247 all species →	POLYCOMB GROUP PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006355 all species →	Biological Process	regulation of DNA-templated transcription	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K11461	SCMH1; polycomb protein SCMH1	-	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074625962.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

69TPM > 0

2Conditions

42.0Max TPM

21.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	36	18.82	41.98
all_coral_tissue · baseline	38	33	24.40	41.29

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	41.98
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	37.54
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.44
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.28
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	34.35
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.50
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.41
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.43
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.76
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.57
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.57
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.21
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.02
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.79
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.67
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.78
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.84
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.42
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.39
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.76
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.60
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.02
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.72
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.68
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.20
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.10
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.90
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.66
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.98
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.62
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.47
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.38
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.76
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.24
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.63
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.85
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	41.29
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	40.89
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.82
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.08
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.60
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.13
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.54
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.64
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.58
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.36
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.29
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.12
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.58
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.31
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.29
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.02
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.84
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.34
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.81
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.67
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.57
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.09
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.21
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.34
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.55
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.80
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.16
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.39
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.16
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.90
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.66
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.68
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.58
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.