Gene detail

Detailed information of XP_074626271.1 in Acropora palmata

Genomic Location: NC_133887.1:15141352...15160781
NR annotation: XP_029212610.2, LOW QUALITY PROTEIN: exosome component 10-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074626271.1

ATGGCTGACCACGCGGAACAAACAAACGTTGCTGGCAATGAGGCTTTGCCTGGAATAGGGGAATTAAGCAGCTTTTCTCAGGATTCTCTTGGTGCCATTGTTGAAGCCATCAAGTCATGCGGTAGCCTGCCAGCTGCAGGAGAGGATCATGATTTATACTACAGTTTTTCAGACTTCCGAGAATTTAGAGCAGCCCAGGGAGCAAGACTTCTTAGCAACATTGGTAATCTCTTACATCATTGGAAAGTGCGCTGTCACTGGCCAAGCGACAGTTTCAACTTAGATCCTGAGGGTGATGAGTTGCTAGACAGTCTTGTGGAAGCCAATGACACCATCCTTGAGTGTGTGGACACAAGCCTTGATGAGGCAGCAGGCCTCAATAAATCAAACAAAACAGCAAATGTGACAATAGCTGGTGTATCTGGGCAACAAGGAACACCTCTTGTGTCCAGCTGGAATAAACACAAGAACTATGCCACTGGTAAAACGGAGAATACATATCGTTTTCTGATGGCCAAAAACATACAAAGACCCCAGCTGAAGTTCAAAGATAGTATTGACAACAGTAATACTCCCTTTATTCCAATAATAAAAAGCAAGCCCAATGCACTGAAACCTCTGCAAACCACAACAAGCATTGAATCAAAAGGTGTGCCATCAGCTATAGCTGACTTTGTCCATCAAGCCAGAATGAAAGCATTTGAAGGTGGACCTTTACTCAACAGCACAACCCATCCCTATCAGTATGAACTGGAAGTCTTTGAGCCACCAGAGAATCAGATGAAGCTTTGCAAAGAGCAACTTTATGAAGAATTGGAGAAGACCCCATACACCTTTGTAGAAACACAACAGCAGCTGGAAGAACTGAGCCAAAACCTGTCTGCTGTCACTGAATTTGCCGTTGACTTGGAGGCTCATTCATATCGGTCTTTCCAAGGATTCTGTTGCTTGATGCAGATATCGACAAGAGATCATGATTATCTTATTGATGTCTTGGAGCTACGAACTGAACTTCATATCCTTAATGATTCCTTTACCAATCCCCATATACTCAAGGTTTTTCATGGAGCAGACATGGATATTGGTTGGCTACAACGAGACTTTGGTATTTATGTTGTGAACATGTTTGACACTGGCCAGGCTGCTCGAGTGCTAAACTATGGGAAGTACTCATTGGCATTCCTGCTGAAGAAGTTCTGTGACGTCACTGCAAATAAACAGTATCAGTTGGCTGACTGGAGAATACGACCTCTGCCACAGGAGATGGTTCATTATGCAAGGGAGGATACGCATTACCTGCTGTACATTTCTGATCGTTTGCACAATGAGCTTCTTAAGAGCGGCAATGCAAACAACAATTTGCTACAGTCTGTGTACTCCAAAAGTAAAAATGTGTGCTTGAAGCGATATGAGAAGCCATTGTTTACTAGTGAATCATTTCAACGAGTGTTGGAGAAACATAAAAAGGCATTTAACACAGAACAGGTCTGTGCCTTTCGTCTTCTCTATGCCTGGAGAGACAATGTTGCTCGAGAGGAAGATGAAAGTTATGGATTTGTTCTTCCAAATCACATGATGTTCCAGATTTCGCAGGTTTTGCCAAGGGATCCCCAAGGGGTGTTAGCGTGTTGTAATCCAGTCCCAACACTTGTCAAGCAGTATGTCAACGAGATCCACCAGTTGATTATGCAAGCAAAGGAACTTGCTCTCAATACAAACAAGGGCTTAACTGGACTGTCGTCACAAGGTGATGGGAGGAGCACATCAAAACCTAAAGAATCGACTCAACAAAGATTGTCACAGCAGTCTTTGGTTGATGGTGATCAGAAATCTAATAATTTACTACTAAATGGTAATACACCGTTTGTCTCCACAAGGCCTAGTCCAGTGGGCCAGATTTTAGCGTCAGGTCCTCCTGTTCATACAAGAGCGAAACCGGCTGTGTCGATCTTTGAGATCTGCCACGAAACACAGCTGACTGATGGGCAAAAGAAAGCAGCGAAAATAAAGGCTTCCTTTGGGAATCCATTTCAAAAGTTTCTTCCTCTGAAGACTCCGTCAGCGACAACAGAAGGTAGCTCAGTCACTGATGACCCGCAGGGTCGTGAAGAGCCTGATGTGAGAAATGGAAGTAACAGCTCGGTAGAAGAAACAGGCACTTTGGAAACAAATGCTGGCACGAAACGTAAAGTATCCGATGATGAAGAGACGCCAGAAGATTTGGCGCCATTGAGAAATAAGAACGCGGCTAAAAAACCCTCACGGAAGAAAAAGCGCGAATCCTGTGAAGAAGGTTCATCCACTTCAAACATCCATGAGAAAGAAGGCTCAGTGACCCTGAATCCGTTCGACTACTCCCAAGCAGATTATTCAACATTTTCGGATCACAGACAGAATGGTAGCGCAGACAAGCCAATAGTGTTCGATCCTTACAGAAACGCCAAAAAATCAAAGGGACCTCGATCTAAAGTACACATGAATTCTGGACAAAAGAATTTCACATTTTCTTCAACCAAAGGATCTGACCACAAACAGAAATTGTCCCGTCGATGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q01780	Exosome complex component 10 OS=Homo sapiens OX=9606 GN=EXOSC10 PE=1 SV=2
P56960	Exosome complex component 10 OS=Mus musculus OX=10090 GN=Exosc10 PE=1 SV=2
D4A1X2	Exosome complex component 10 OS=Rattus norvegicus OX=10116 GN=Exosc10 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003985 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF08066 all species →	PMC2NT	PMC2NT (NUC016) domain	Domain	Interproscan
PF01612 all species →	DNA_pol_A_exo1	3'-5' exonuclease	Domain	Interproscan
PF00570 all species →	HRDC	HRDC domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR012588 all species →	Domain	Exosome-associated factor Rrp6, N-terminal	Interproscan
IPR002121 all species →	Domain	HRDC domain	Interproscan
IPR012337 all species →	Homologous_superfamily	Ribonuclease H-like superfamily	Interproscan
IPR002562 all species →	Domain	3'-5' exonuclease domain	Interproscan
IPR044876 all species →	Homologous_superfamily	HRDC domain superfamily	Interproscan
IPR010997 all species →	Homologous_superfamily	HRDC-like superfamily	Interproscan
IPR036397 all species →	Homologous_superfamily	Ribonuclease H superfamily	Interproscan
IPR045092 all species →	Family	Exosome complex exonuclease Rrp6-like	Interproscan
IPR049559 all species →	Domain	Rrp6-like, 3'-5' exonuclease domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12124 all species →	POLYMYOSITIS/SCLERODERMA AUTOANTIGEN-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000176 all species →	Cellular Component	nuclear exosome (RNase complex)	Interproscan
GO:0006396 all species →	Biological Process	RNA processing	Interproscan
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan
GO:0006139 all species →	Biological Process	nucleobase-containing compound metabolic process	Interproscan
GO:0008408 all species →	Molecular Function	3'-5' exonuclease activity	Interproscan
GO:0000166 all species →	Molecular Function	nucleotide binding	Interproscan
GO:0044237 all species →	Biological Process	obsolete cellular metabolic process	Interproscan
GO:0000175 all species →	Molecular Function	3'-5'-RNA exonuclease activity	Interproscan
GO:0000467 all species →	Biological Process	exonucleolytic trimming to generate mature 3'-end of 5.8S rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)	Interproscan
GO:0003727 all species →	Molecular Function	single-stranded RNA binding	Interproscan
GO:0005730 all species →	Cellular Component	nucleolus	Interproscan
GO:0071035 all species →	Biological Process	nuclear polyadenylation-dependent rRNA catabolic process	Interproscan
GO:0071036 all species →	Biological Process	nuclear polyadenylation-dependent snoRNA catabolic process	Interproscan
GO:0071037 all species →	Biological Process	nuclear polyadenylation-dependent snRNA catabolic process	Interproscan
GO:0071038 all species →	Biological Process	TRAMP-dependent tRNA surveillance pathway	Interproscan
GO:0071039 all species →	Biological Process	nuclear polyadenylation-dependent CUT catabolic process	Interproscan
GO:0071040 all species →	Biological Process	nuclear polyadenylation-dependent antisense transcript catabolic process	Interproscan
GO:0071044 all species →	Biological Process	histone mRNA catabolic process	Interproscan
GO:0071051 all species →	Biological Process	poly(A)-dependent snoRNA 3'-end processing	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K12591	RRP6, EXOSC10; exosome complex exonuclease RRP6	EC:3.1.13.-	Messenger RNA biogenesis	ko03019	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074626271.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

65TPM > 0

2Conditions

30.2Max TPM

14.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	36	13.54	30.19
all_coral_tissue · baseline	38	29	14.74	29.84

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.19
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.71
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.66
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.23
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.29
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.81
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.75
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.54
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.95
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.69
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.59
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.44
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.98
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.85
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.84
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.70
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.57
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.08
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.04
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.63
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.20
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.83
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.03
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.90
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.26
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.06
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.18
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.42
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.50
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.19
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.35
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.24
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.44
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.12
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.55
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.89
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.84
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.00
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.27
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.80
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.96
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.49
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.36
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.53
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.45
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.23
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.42
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.87
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.90
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.48
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.39
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.34
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.23
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.67
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.55
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.69
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.01
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.55
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.93
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.75
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.99
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.31
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.70
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.94
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.64
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.