Gene detail

Detailed information of XP_074626475.1 in Acropora palmata

Genomic Location: NC_133887.1:22677172...22692432
NR annotation: XP_029206897.2, phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit beta isoform-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074626475.1

ATGCCTCCAGGATCGCGACAAAACTATTGGGACAAATTAACTACAGCTAGCGTAGCTGTGGACTGTTTTCTTCCCACAGGAGTCGTAATACAACTTGATGAAGTGCGGATCGAGGCGCCACTGTCAGAGATAAAAAATCGTTTGTGGAGAGAAGCAAGCACTTATCCGCTGTTCAATCTGCTGACAGATGCGGGGAAAAACGCTTCAAACTACTCGTTTCTTTGCGTAAATCAAAGAGGCAAACAAGAAGAACTTGTCGATGAATCTCGACCACTTAACGAAGTCAAGCCTTTTCGACCGCTTCTGAAGCTAATACACAGGAAAGGTGATAATGAAGAAAAACTCCTGAACTCGACAATCGGAAACCTCATTGGGAAAAGTTTGCATGAATTTGATCAAATGCAAAACCAGGAGGTGGACGACTTCAGGCGTAAATATCGCAAGTTTGTGGAAAAGCTAGCAAGCAATCGAAGGCAACTCAGTTGGATTGGTCGAGCAATGTATGCCTACCCCCCGGAAATCGAAACTACACCTCTGCCTTTACACATCGAAGAAAACCTGTCGGATGACAGGCGATTTTTAGTGAATGTAGCGATCAAGAACAATCGGGCATCGATAAAAGACATGCATGCCTTCAGTCTTCCTGCTGATGCGTACCCTGATGAAGTTATTGTGTTAGTATTGGACAAAAGGGGTAAAATAATGGGTGTCCCAGATCTTGATAAGCCTGTGGATTACGTTTTGAAGATTGTTGGTCGAGAAAGCTACTTGTTGGGAAATTATCCATTATTACAATACACGTATATCCGCACTTGTATAGCTAAAGGCGTAAGACCAATGCTGTCACTGGTACTTCGAGCTTCTCTTCAAGTAGAAGTTGATGTAACTGGGTTTTGTACATCAACTCAGCGAGCAGCGCCACCTCCGTTACCTCAGAAGCCTCTGTCAGCAAATTTGTCACTGTGGAATATTCAAACACATGTGAGAATCAAAGTTGTTTCAGCTGCTAATGTCAATGCTGGTGACTTGATGAAGGTGTGTGTCCGAGCAGGAATTTATCATGGTAGTGAAGCCTTGTGTGACATTGTAACCACGAAGCCAGAGGGAGGATCAAACCCCATGTGGAATGAGTACTTGGACTTTGATCTTGATGTGTGTAACATTCCCCGCGTGGCTCGGCTGTGCCTTGTTATTTACAGCATTTATGTTGACAGAAGGAGGACTAGAAATAAGAGAAGTGAAAGCATTCCAGTTGCCTGGGTGAACACTACTCTTTTTGACTATCAAGGAAAACTGCGGCAAGGTGAACTGCAGCTGTTTGCTTGGCCAGTACCTGAGACTATGGCAGATCAACTTAATCCTGTTGGCACAGTGGTATCAAACATTGATACTGTCACCTCAGTGTCGCTTTATCTGGAGTTTCAACGTTATTCCAATGCTGTGGTCTATCCATCATTTGATACGGTTGCTGAACTGGCTGCACAACACATTAATGCCAATATTTTTGGAAATGCTGAACAATCTCAACTGGAAAAACTCAAGCAGATAGTCAATCGTGAACCACTTGCACCAATTTTTGAGCAAGAGAAGGATCTTGTATGGGAAAGAAGAATTGATGTTCGTGAGCATTTTCCACATGCTCTTGCTAAACTGCTCTGTTGCGTCAAGTGGAACAGCAGACAGGATGTTGCAATGATGCAAATTCTTCTGCAAACTTGGCCCAAGCTAGAGTCAGAACAAGCTTTAGAATTACTGGATTATACTTTTGCTGATCAGGCAGTCAGGAGGATTGCTGTGGAGTGTATTGAAAAAATGAGTGACAGGGAGATTTCACAATATCTTCTGCAGCTGGTTCAGGTGTTGAAGTATGAATCATACCTGGACTGTGAGTTGGCTGAATTTCTCCTCCGAAGAGCTCTAAACAATCAACACTTTGGACATGCACTGTATTGGCTTCTCAGAGCTGAAATGGAAAATCCAGAAGTTTCTGTTAGGTTTGGATTAATGTTGGAGGCCTACTGCCGCGGAGCACCAGCACACATGAAAAGTTTGCAGCGCCAGGCCCAAGCTCTTAGCAAAATGAAGTCTGTCACAGAATTGCTTCAGCTGATAGACAGAGATAGGCGAGAGAGGGGTTTGGCAACAATGAAGGAACTGCTTCGCCAGAAGACCTACCAAGGAGCACTTTCCAAGCTTAGTTCTCCACTGGATCCAAGTTTCAAACTGCGGAATTTGAATGTCGATCAGTGCAAATATATGGATTCTAAAATGCGTCCACTGTATTTAGTGTTCGAAAATACAGATGAATTGGGTGATCTTGTCCGTATTATTTTCAAGAATGGTGATGACCTCCGTCAAGACATGCTCACCTTGCAGCTGATCAGAATCATGGACAGAATTTGGCAGAACGAGGGTCTGGACTTGGGCATGATTCCTTACGGCTGTTTGTCGACCGGCAGTAATGTTGGTATGATCGAGGTTGTTTATCAGGCAGAAACGTTGGCCAAATTGCAGAGAAGAAGAGGTGGGGTCACTGCTGCATTCAGTAGAGATTCTATCTGGGTCTGGCTACAAGAGTATCATGCTACCGAAGAAAGTTTGACAGATGCCGTCGAGCGGTTCACACTGTCCTGCGTAGGGTACTGTGTGGCTACATACGTCCTGGGGGTGGGGGACAGGCACAGTGACAACATCATGGTGAAGAATACAGGCCAGCTTTTCCACATTGATTTTGGGCACATCTTGGGCAACTTCAAACGGAAATTTGGTGTTCAACGTGAAAGGGTTCCTTTTGTATTGAGTGACCAGTTTGTTCACGTTATTACTATGGCCAGCGAAAAAGGACGGGAAACATCGCAGTATGAAAGATTTAACCACCTTTGCAGAGAGGCGTTTCTTATCATTCGACGCAAAGGCGCATTGTTGATCAACCTCTTTGTGATGATGTTATCGGCTGGTCTCCCTGAACTGCGGTCGCTGGATGATATTGGCTACTTGCGTAAGACATTGAGGCTGGATCTATCCGAGGAGGAAGCGGTCAGAGACTTTCAGAAGAAGTTTGAAGCTGCTATTAACAACAGCTGGAAAACCTCCATGAATTGGTTTGCCCACAACGTAAAGCGTGATAACCCGTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9Z1L0	Phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit beta isoform OS=Rattus norvegicus OX=10116 GN=Pik3cb PE=2 SV=1
Q8BTI9	Phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit beta isoform OS=Mus musculus OX=10090 GN=Pik3cb PE=1 SV=2
P42338	Phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit beta isoform OS=Homo sapiens OX=9606 GN=PIK3CB PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001304 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00794 all species →	PI3K_rbd	PI3-kinase family, ras-binding domain	Domain	Interproscan
PF00613 all species →	PI3Ka	Phosphoinositide 3-kinase family, accessory domain (PIK domain)	Repeat	Interproscan
PF02192 all species →	PI3K_p85B	PI3-kinase family, p85-binding domain	Family	Interproscan
PF00792 all species →	PI3K_C2	Phosphoinositide 3-kinase C2	Domain	Interproscan
PF00454 all species →	PI3_PI4_kinase	Phosphatidylinositol 3- and 4-kinase	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000341 all species →	Domain	Phosphatidylinositol 3-kinase Ras-binding (PI3K RBD) domain	Interproscan
IPR011009 all species →	Homologous_superfamily	Protein kinase-like domain superfamily	Interproscan
IPR000403 all species →	Domain	Phosphatidylinositol 3-/4-kinase, catalytic domain	Interproscan
IPR042236 all species →	Homologous_superfamily	Phosphoinositide 3-kinase, accessory (PIK) domain superfamily	Interproscan
IPR002420 all species →	Domain	C2 phosphatidylinositol 3-kinase-type domain	Interproscan
IPR001263 all species →	Domain	Phosphoinositide 3-kinase, accessory (PIK) domain	Interproscan
IPR029071 all species →	Homologous_superfamily	Ubiquitin-like domain superfamily	Interproscan
IPR003113 all species →	Domain	Phosphatidylinositol 3-kinase, adaptor-binding domain	Interproscan
IPR015433 all species →	Family	Phosphatidylinositol kinase	Interproscan
IPR018936 all species →	Conserved_site	Phosphatidylinositol 3/4-kinase, conserved site	Interproscan
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan
IPR035892 all species →	Homologous_superfamily	C2 domain superfamily	Interproscan
IPR036940 all species →	Homologous_superfamily	Phosphatidylinositol 3-/4-kinase, catalytic domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10048 all species →	PHOSPHATIDYLINOSITOL KINASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0005942 all species →	Cellular Component	phosphatidylinositol 3-kinase complex	Interproscan
GO:0014065 all species →	Biological Process	obsolete phosphatidylinositol 3-kinase signaling	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0016303 all species →	Molecular Function	1-phosphatidylinositol-3-kinase activity	Interproscan
GO:0016477 all species →	Biological Process	cell migration	Interproscan
GO:0035005 all species →	Molecular Function	1-phosphatidylinositol-4-phosphate 3-kinase activity	Interproscan
GO:0036092 all species →	Biological Process	phosphatidylinositol-3-phosphate biosynthetic process	Interproscan
GO:0046854 all species →	Biological Process	phosphatidylinositol phosphate biosynthetic process	Interproscan
GO:0048015 all species →	Biological Process	phosphatidylinositol-mediated signaling	Interproscan
GO:0052742 all species →	Molecular Function	phosphatidylinositol kinase activity	Interproscan
GO:0016301 all species →	Molecular Function	kinase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K00922	PIK3CA_B_D; phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha/beta/delta	EC:2.7.1.153	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074626475.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

79TPM > 0

2Conditions

117.4Max TPM

56.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	44	54.17	117.42
all_coral_tissue · baseline	38	35	59.72	108.22

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	117.42
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	107.40
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	101.84
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	99.16
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	98.50
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	95.02
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	90.67
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	86.02
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	83.76
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	83.41
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	82.58
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	80.18
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	78.12
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	77.44
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	77.42
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	76.72
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	76.49
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	70.29
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	68.15
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	67.91
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	65.92
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	64.91
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	64.17
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	57.20
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	54.99
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	47.17
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	41.22
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.28
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.53
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.55
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.36
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.28
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.50
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.52
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.28
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.51
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.07
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.80
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.99
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.87
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.12
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.13
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.79
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.06
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	108.22
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	95.07
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	93.55
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	87.74
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	86.26
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	84.45
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	84.24
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	83.53
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	83.48
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	81.81
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	81.61
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	81.31
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	76.05
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	75.65
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	75.40
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	71.95
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	70.15
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	70.14
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	69.76
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	69.19
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	69.06
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	67.78
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	64.69
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	63.02
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	61.31
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	47.50
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	43.14
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	38.23
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	38.18
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.96
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.67
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.71
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.56
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.74
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.08
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.