Gene detail

Detailed information of XP_074627985.1 in Acropora palmata

Genomic Location: NC_133888.1:4519842...4539973
NR annotation: XP_044183191.1, endosome/lysosome-associated apoptosis and autophagy regulator family member 2-like isoform X2 [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074627985.1

ATGGCGAGTGCAACGTTAGTTGCAACAGTACTGTGTTTGCTCTTGGTTCCTACGACAGTAACACAGAAAACGTGTACCAGAAACGATTATGTTCGGCAAATGCTACCGTGCGATGAAAAGACACTGACTCGATCCGTGGTCTATTACCTCAACTCTAATTGCACTGGTGGGGATTATGCCCCAGTGCCAACTCATAGATTGCCTTGCTACTGTCCACAAGGAAAGGGATTGGCCAGTGATGGCAAAAATTGTGCATCTTGCAAAAAAGGTGAATTTGGATCAGGAGGTGAAGTCATCAACAACTGGAACATGTGGACTGAGAACGGCACAAAACCTCCTGAAAGATCCGACATGGTCAATTACTGTGAATTTACACGACCTTTTAACTCTAAATATGTGTGCAATCCCTGGAAAGCAAGTGTGGATAATTACACACTTGAATCTGGAGAGCATTCGGCAACAAGATGTGTATCATCAGTGTTGCTTATGACCAAAAAGTTCATCCAACCCAACAACAACAAAGTTAGTTTTGATTATCGCGTCGATAGCCGCTACTGCAGAGGAGTGTATTATGGCTGTGATGGGCTTGCCTTCTTTGTCAACAACAAGATGGTCTTGGATTATTCAGGAAGCCAGTTTCAGTGGACCACCTTGACATACAATTTAAAACCTGGCACTCATACTCTGAAATGGGTATACCACAAGTCCTGCTATAGTTATGCAGTTTCTTTTGTTGACAAAGCTTTTATTCGTTCTATTACATTGGTTGGCACAGAAGAACCAAATATAAGCTGTACAAAATGCCCACCTGGTTACTATAGCAAGATAGGTGGAGCTTCCAATTGCACTGCCTGCTCTTATTTTGAGTATCAGTCCAAAGAAGGCCAGCAGCAATGTGACATCTGTCCACAAGATACCTATTCCATGTTGGGAGCATCAAAGTGTCTCCCTTTACCGAACTGTACAGATGATGACATCATCAAAGCACCTGACAACCTTGATAGCTGCTCATGTACCCCTCCTACAATGTGCAGAACAACTGTGGTACCTTCCTATGTCAAAGTCAGAGGCTTTAAAATTGGCTCCAGGCTTCTCTGTAAGAACCAGGATGATTCCAAACTTAAGCCGCAACTGGTTCAGTGTCGTTGCCAACCTGGGTACGAGATAGTAAACAGTAATGGTAAGAAACAGTGCCATCTTTGTGATAAAGGAAGCTTCTCAACAGATGGTATCAAATGTGCACGTTGTGAGGCTGGTCATGTTGCTTTACGAGGAAAGCATTTCTATGTTTGGCGAAACAATACTTTACCACACGGATTTTTTACCGACTGTTTTGGTGACTGCAGTGTGAAGGGTGGCTGGATACCAGCAGGTGGCGATATCCGCACTGAGCGTGTTGTTGGAGACTTGTTCACCGTTCTCAATTCTCCAGAGGTAGAAATTGTTTCGGAGCTGGGAAAAATCATGTTCATTTGTTCGGTGACGTGTAACTTGACAGGGGTAGCCCCAAAGGGCACCCCAGGAGAGCACCTCTCAAAGATAAACGATTGCAACCTTATCTTTCAAGTACTCCATAATGATACCCTCCGGGAGGAAGTCAATTGCACATACCCAAGAGGAGGATATCAGTACAGACACGAATGGAACCGAGACGGTCGAATTATGACACATATTTTACCACTAAAAAAGGGCAGATATTCCTTCAGGTGGATATTTCACCAACAAGACGAGACACTAGGTCTTTCCACTGCGTTTGAAGGAAAAGTTTACAACATTAGCATCGTGGGTACAAAAGAAGGGTCAGCTCTTAACTGCACTCCCTGTCCAGCTGGGTATCACAGCAGTGCAAACAATACGGACTGTGCAATTTGCCCAAATGGGACAGCAAGCAAGAAAGGATCTGAAAAATGCACCCCATGCGACGGAAATTCATTTGCTGCCAAGATGGGTAGCGAAACTTGTATACCTTGCGGTGAAAACACCACGGTCTATCCAGGTAAAGATGGATGCGACACGAATGACTGTAAGTTTACCCCTGCAGAAGGAGTGGAATATGATCTTAGTGCCCTTTCGCGCGAAGATGGACCAATGGTAAAAGCGTTGCTTTATCGAGTACAGCCACGATCGCGAAGAAGGACCGTCATTTGGCCATACAGACCGTCTCTTTATTTCAACCTTTGCACACTTAAACATGACAATTCATCATGCTTGGGGCCACGGAATATGACCACTGGGCAGCGCGATCCCCTTCCCGTCATGGCTTGCAGGTCGTCGTGGGGGCGACGCGATACTGATATTGGATCGGTGATTGGTTACAGAGCAAAAAAAGACGTCCGCTCCGGTTTATATGTGGATTTGTTGCACGGCGATCTTTGTTATTATGGAAGAGGATCCCAGAGACGGTACCAAACAACCCTCGATTTGAGATGTAACATCTACGCCGATGTGGGCAACCCAGGCCCCGAAAACAATCGCTCCGGCTATTACTTTAAGTTTCCCTGTGGGTATTACTTGGTGTGGGAATCTTTGTACGCTTGCCCAAAATGCCAGGGACACGAAGTTGAAAAGGTCGTCGGTGAATGCATAAACGGAACCCGAAACGTCACTTCCGTGCGATCTGTACACTGTTGGGGGACTGGGAGAAAGGACGAGATAGAGGTCCCCATCGAACCCTGCCCAGTCGTGTCTTCGGTTAATGACACAATCGTTCTGTATCACACGGAAAAAAGCTCCGGTAACGCAATCAAGATCGTAATAGGTGTATGTGTGCCAGTGATTCTGGTTTTGCTAGGCATAGTGCTGTTTTTTGTGTACAGACATCGCACGATGAAATATCGTTATTTCAACTCGTTGGCACGCGAAAAACCCATGAGTCGACTCGCTGAAGAGGACGAACTCGATGAGGAATTCAATGAGTCATCTCCTTGTTCAAAAACTTAA

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003441 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF07699 all species →	Ephrin_rec_like	Tyrosine-protein kinase ephrin type A/B receptor-like	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR011641 all species →	Domain	Tyrosine-protein kinase ephrin type A/B receptor-like	Interproscan
IPR009011 all species →	Homologous_superfamily	Mannose-6-phosphate receptor binding domain superfamily	Interproscan
IPR009030 all species →	Homologous_superfamily	Growth factor receptor cysteine-rich domain superfamily	Interproscan
IPR044865 all species →	Domain	MRH domain	Interproscan
IPR039181 all species →	Family	EIG121-like	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR22727 all species →	PROTEIN CBG13728	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016021 all species →	Cellular Component	membrane	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for XP_074627985.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074627985.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

77TPM > 0

2Conditions

105.9Max TPM

37.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	42	33.62	86.51
all_coral_tissue · baseline	38	35	41.58	105.89

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	86.51
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	81.33
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	78.67
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	78.08
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	76.50
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	64.29
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	63.87
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	63.69
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	61.56
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	59.75
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	55.45
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	53.91
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	53.61
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	53.16
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	52.59
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	52.41
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	51.83
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	50.03
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	42.60
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	40.51
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	39.61
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	36.73
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.69
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.73
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.35
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.49
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.68
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.48
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.05
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.72
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.70
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.24
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.45
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.41
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.11
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.08
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.10
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.35
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.87
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.47
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.78
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.87
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	105.89
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	84.72
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	80.14
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	69.24
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	68.32
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	65.93
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	64.18
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	62.16
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	61.06
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	59.37
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	56.81
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	55.52
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	54.04
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	53.19
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	50.54
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	49.89
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	49.19
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	46.86
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	46.83
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	46.66
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	46.63
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	44.19
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	42.32
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	41.67
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.70
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.90
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.69
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.21
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.04
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.64
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.87
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.10
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.32
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.26
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.88
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.