Gene detail

Detailed information of XP_074628136.1 in Acropora palmata

Genomic Location: NC_133888.1:19796237...19819258
NR annotation: XP_044183163.1, centromere/kinetochore protein zw10 homolog [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074628136.1

ATGGCGGAAGACGTGGTTAAAACAGAAATTTCTAAAATTCGTAAGCCAAGTGCGAGTTTGGTCACAGATGTTCTTCTTAAATCTGGCTGTCTAGAAAAAGAAGATATAAATGCTTGCGTGAAGAAGACGCTACAAAAAGCAGAAGAAGTGAAGGTAGAGGTTCTTCAAGTCATTTACAAGGAATACACCTTTGACGAATTTGTGGATTTCAGTAATTCAACCTTTGAAATGAACTGGAAAGTTAACAATCTTCTAAGTGAAATACAAAATGTTTCTGGCAAAGTTAAGGGTTCAGTTGAAGGGTCTCTGGAGGCAGCTGCACGTGAACATAGTGAGCTAGTAAAACAGTTAAAAGAAGCAGACGCCATTGCAGAGCTTCTTGAGAGACTGTACAAGATACATGAAGCTCTAGATGCATTTCCAGCTGAAATGAACAAGGAAGATTACACCAAAGCTGCTAATCTTGTACATGATGTGAAACAACTGCTTTCCAATTTGCCGAAGGTTGGACAGGAAGGAAAGATCTTTGTCTCTCTTTGGGATGAATGGCATAGACAAAGGGCTCAGCTGACAGCCACTCTAGAAAGAATATGGGCCAGAAGTGTTGCCTGGACAACACCTGCAGCAGCATCTCTAGATAATAGACAGGGACATCTTAATACACAACTGAAGCTAAACACAGGTGGCTGCTTAATGGCAAATGTCCTTGAAGCCATGCAAATTCTTGGCATCGTGGAGAAACTATTGCATTCTTTTGGAAAGAAGGTTGTTCAGTATATCTTCAGGCCTTTGATTGTCTTTCCAAGCCTTAAGCCAGAGATCAGTGTGAAAAACCAGGAGATTGTCTTATCATTTGTCAAGGAAGGTCGCAAAAAAGTCATTGATCCTGGACTATTGTATTTAAAATTTTCTGAGATTTTTACTGTTTTGGGCACCTTTTTTGATGGGACAAGCATTAAAGATGAAAATTTGAAGTCCAATGATATCAATGTGAAAAGTGCTGCACTCTTTGCTAAACTTGGTGAGTTTGTGTGGCCAGTACTGTTGGAAAATATCATCAATGAGTGCCTCAAAAGATCAGTCCCTACAACAAGTGCACAGTTAGAAAGGTATCAAGATGTTGTTAAGAACACAGAAGAGTTTGAAGCAAAACTTGTCTCTTTAGGTTTCATACCTGAAGGAACAACAGATCTCACCTCGTATGTAAAAGACGTTGGAATACACTTTGGAAACAAGAAGTGTCAAGATCTTCTGGTTGTGGCACGTGATTTGATGAAAGATGACATACATAACACTGTACAAGTGGACAGCAACACAGACAAAGCAGTGCTTGCCAATCTTGGAGATGTTGAGAAAGCCTTACAAGGAAAAAAAGGAACAAAGTTTGTACCATTGCAAAGGGATGAAGGAACCACCGTGAGTAAGTTCACATTTTGCCTCCCAGCTTGCCGCATCAGTGAAAGCACAGAGAAGCTGATGACTCTTGCTTATAAAACTCTTTTTGAAGCTGTGCAGTCTACACCAACATGTGCTATTCAGTTGTTCTACACAGTGCGTAATATGTTTGAGTTGTACTGCAATGTGGTCCCAACCTATCACAAACAACGTTTGGCCACTTTGCCACAGCTTGCAGCTTTACACCATAACAACTGCATGTACATTGCCCACCATCTCCTGACACTTGGCCACCAGTTCAGACCCAGGCTACCTGAGCCTCTCAATCAGGGTATGGCTTCATTCGTGGATCTGGTACCAGTCATTCGACAAATTGGCGAGAAATGCTTTCTTGATCAGCTGAAAATACAACAGTCGAATTTGTTGGAGCTGGTAAAAAACACCCAAGGCTTTGCAAATGTTCACGAGGAAGCGAAAAATTTGCAAGTGGAGAAAACAATGAAGCAGATTCTTCACCTTTTGACAAATCTTGGTAAAGTATGGAAGGGTATTCTTCCAATTAACATTTACTGCCAATCTCTGGGAGCATTATTTGATGATGTTATTCAGTACATAGCATGGGAGGTGCTTCAGCTTGAGGATATTTCTGCTGATGAGGCAGATCACTTACCTTCTTTACTTTCCATCCTTGTGCAAAGAGGATCAGAGATTTTTCAAACTACTCCAGAAACAGATTCATCATCAGATGACAGTGTTTGGGACATATGCACAGTTGTGCCTCACTGGACACGCTATAAGGAGCTGATTGGAATCTTAAAAGCCAGCTTACAAGAAATTGGAGATCGTTGGACAGATGGAAAGGGTCCCTTGGCTCAAGAATTTACAGCACAGGAAGTGCGTGGACTCATAAGAGCTATTTTCCAAAACACAGACAGACGGGCTGCCATTTTGGCAAAGATCAAAGCCGTATAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O43264	Centromere/kinetochore protein zw10 homolog OS=Homo sapiens OX=9606 GN=ZW10 PE=1 SV=3
Q5RFM4	Centromere/kinetochore protein zw10 homolog OS=Pongo abelii OX=9601 GN=ZW10 PE=2 SV=3
Q4V8C2	Centromere/kinetochore protein zw10 homolog OS=Rattus norvegicus OX=10116 GN=Zw10 PE=2 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005484 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF20665 all species →	Zw10_middle	Centromere/kinetochore protein zw10, middle domain	Repeat	Interproscan
PF06248 all species →	Zw10_N	Centromere/kinetochore Zw10 N-terminal	Repeat	Interproscan
PF20666 all species →	ZW10_C	Centromere/kinetochore protein zw10, C-terminal	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR046362 all species →	Homologous_superfamily	Zw10/DSL1, C-terminal	Interproscan
IPR048344 all species →	Domain	Centromere/kinetochore protein zw10, middle domain	Interproscan
IPR009361 all species →	Domain	Centromere/kinetochore protein zw10, N-terminal	Interproscan
IPR048343 all species →	Domain	Centromere/kinetochore protein zw10, C-terminal domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12205 all species →	CENTROMERE/KINETOCHORE PROTEIN ZW10	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000278 all species →	Biological Process	mitotic cell cycle	Interproscan
GO:0000775 all species →	Cellular Component	chromosome, centromeric region	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006888 all species →	Biological Process	endoplasmic reticulum to Golgi vesicle-mediated transport	Interproscan
GO:0007094 all species →	Biological Process	mitotic spindle assembly checkpoint signaling	Interproscan
GO:1990423 all species →	Cellular Component	RZZ complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K11578	ZW10, DSL1; protein transport protein DSL1/ZW10	-	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074628136.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

57TPM > 0

2Conditions

13.4Max TPM

6.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	30	5.05	12.55
all_coral_tissue · baseline	38	27	7.41	13.40

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.55
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.69
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.28
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.23
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.17
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.75
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.74
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.81
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.07
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.03
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.90
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.84
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.68
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.47
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.23
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.11
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.98
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.95
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.87
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.81
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.75
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.68
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.64
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.55
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.37
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.48
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.25
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.83
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.22
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.35
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.40
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.39
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.33
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.23
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.21
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.65
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.22
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.15
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.06
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.01
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.99
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.72
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.67
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.46
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.22
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.58
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.57
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.07
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.68
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.45
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.43
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.40
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.98
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.83
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.57
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.35
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.90
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.