Gene detail

Detailed information of XP_074629294.1 in Acropora palmata

Genomic Location: NC_133888.1:16930102...16955791
NR annotation: XP_044164920.1, LOW QUALITY PROTEIN: prolyl endopeptidase FAP-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074629294.1

ATGGCCACTCAGTACTCTGTGGCTGGTGCAGACTCGAGCGAACAAGTTCGACTGATTAAAGATGAGGAGGAAGAAACAAATTCGACTACTTCTCGTCTTAACAGAAAGAGTTTGGGGATTTTTTTGGGAATCACTGGTTTGGCAATTGCTATTATAGTTTGCACTGTACTGCTTACTTTATATTCTGGAAAAGATCATCTAAACCATTTACCATCCGGACCATCTAGTACAAGAACAGCACGTGCTGAGTCAAAAAGAAAATTTAAATTTGAAGATATATTCAATGGAGAATATTCAGCGCAAGGGTACTCTTGCAACTGGGTTTCAGATGACCAGTATATAACATCCAGGGCAGATTTTGGCTTAGAACTAGTTGATTTGACCAAAAATGAATCAGTGCTGCTGCTAAGTGAAATTGATAAGGAAAGACTGAACTTTGAACATTACTGGTTTTCACCTGATAGACAGTACATATTGTTTACTAAATACCAAAAACAGCAATATAGATATTCCTTCTTGGCTGAGTATCATGTCTATAATATTGATACCAAGAAAACATTCCAACTGAAGCCTGGAGTACCAGATGAAGATCCATCAAAAATACAATATGCTACATGGGGGCAGAAAAAGAATTGCCTGGTGTTTGTTTATGGAAATGACATCTATTACTTGGATTCACCATCCATGAGTGGTAAAGTTGAGCAATTGACTGACAGTGGGGTAGAACACAAAATCTTTAATGGAGTTCCTGACTGGGTGTATCAAGAGGAAGTGTTGAATTCAGACCATGCCCTTTGGTTTTCACCTGACAGCAGATTCCTGGCTTATATTCAGTTTAATGACACTTCAGTTAGATGGTATCAGTTCCCTTGGTATGGGAACAGGAAAAACGCATATACCTCTCTTCGAAAGATTGCTTATCCCAAACCTGGATACTCAAACCCCACGGTTAAAGTGTTTGTTGTGGACCTCGTGGCTCAGAAACGGATTGAGCTTCCTGAACCAGCTGACTTTATGAAGATAGACCATTATGTTGTAAATGTGGGTTGGTTGTCAAATAAAGCTGTGACTGTCCAATGGTTAAACAGAGATCAGAACCACGCTGTTCTGCATATGTGCGAAGGAAACTCTGAATCTCATTTCTTTTGCAAACAGAATTCCGAGCTGAAAGTGGAAGGTGGATGGGTTAATGATCAGTACGTCACACCCCTGTCATCTGGTGATGGTTCATATTACATCACACTGTGGCCATTTACTCAGGGTCGGCATGGGCAATTTATTCATCTGGCAAAATTCAGTTCCCACCCACAGGGTTACCAAACTCCACAAGCATTAACCAGTGGACCTTGGGAAGTGCGCAAGATTCTTGCATTTGATACTGTCTCTGAAATAGTATACTTCAAAGCATCCCAGAAATCACCAACACAGTCTCATATTTACAGTGTTAATATAAGAACAAAAGAAGTTAACTGCTGGACTTGTAATCTAGCAACACTAACGCCTGGGAACAAGTGTTCTTATTATGACGCCAGTTTCAGCCTTAAGGGGAGCTGGTACTTACTAAACTGTCGAGGACCAGAACTGCCTGAAATATCCATACGCAGTACAAAAAACAATAAAGTGATCCCAATTGAATACAATGAAGATCTGAGGGAAAGACTAGCCAAGTTGTCTCGGCCAAAAGTGGAACAGTACACAGTGAGAGCTGGCAGCTATGATCTACATGTTAAGGAATACCGACCTCCCAACTTTGATGTGAGCAAGAAATATGCTGTATTGTTCTCAGTTTATGGTGGACCAGGATCACAAAAGGTGACAGATACGTATGGTTATGGCTTTGAAAGTGGTTATCTTGTGAGCAACTTTGATTTGGTTGTGGTTAATCTTGATGCCAGGGGAACCTGTTGTAGAGGAGAAAGATTTAAGCATGCTGTTTATAAGCAAATAGGGAAAGCGGAGGCAGAGGATACAATAGCTGTGGCTAAGTATGTAGCTTCAAAGCCTTATGTGGATGAGAACAAGATTGCTATCTGGGGATGGTCATATGGAGGTTTCCTCACGTCTTACGTGCTTGGTCAGAACTCTAATGTGTTCAAGGTTGGCATGGCTGTGGCACCTGTAACAGACTGGAGATATTATGATTCAATTTACACGGAACGATACATGCTCACTCCACAGGAAAATCATGAAGGATATGAGGTATCGTCAGTGTTACCTTTGGCTAACAATTTCAAGAATGAAAGTTTCCTTGTTGTGCATGGCACAGGGGATGATAACGTACATTTTCAGAATACTGCACAACTGGTGGCAGCTCTTACCAAGGCTGGAATGAAATACCAAGTTCAATTTTACCCAGACAAGAATCACGGACTTAGTGGTGGTGGGACAACAGATCATTTGTATCATCTGCTGACAAGATTCCTCACTGAGAAACTATCACTGCGTAGTTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P97321	Prolyl endopeptidase FAP OS=Mus musculus OX=10090 GN=Fap PE=1 SV=1
Q12884	Prolyl endopeptidase FAP OS=Homo sapiens OX=9606 GN=FAP PE=1 SV=5
A5D7B7	Prolyl endopeptidase FAP OS=Bos taurus OX=9913 GN=FAP PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001275 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00326 all species →	Peptidase_S9	Prolyl oligopeptidase family	Domain	Interproscan
PF00930 all species →	DPPIV_N	Dipeptidyl peptidase IV (DPP IV) N-terminal region	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001375 all species →	Domain	Peptidase S9, prolyl oligopeptidase, catalytic domain	Interproscan
IPR029058 all species →	Homologous_superfamily	Alpha/Beta hydrolase fold	Interproscan
IPR002469 all species →	Domain	Dipeptidylpeptidase IV, N-terminal domain	Interproscan
IPR050278 all species →	Family	Serine Protease S9B/DPPIV Subfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11731 all species →	PROTEASE FAMILY S9B,C DIPEPTIDYL-PEPTIDASE IV-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0006508 all species →	Biological Process	proteolysis	Interproscan
GO:0008236 all species →	Molecular Function	serine-type peptidase activity	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0008239 all species →	Molecular Function	dipeptidyl-peptidase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for XP_074629294.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074629294.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

84TPM > 0

2Conditions

163.1Max TPM

80.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	46	74.62	163.07
all_coral_tissue · baseline	38	38	87.45	151.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	163.07
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	156.65
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	149.58
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	146.24
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	145.22
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	136.67
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	135.38
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	134.43
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	131.24
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	130.60
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	128.94
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	125.61
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	117.24
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	116.62
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	115.95
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	109.22
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	107.25
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	104.90
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	104.32
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	96.95
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	96.94
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	93.14
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	91.58
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	84.06
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	83.92
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	80.94
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	39.77
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.29
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.95
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.68
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.04
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.87
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.75
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.47
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.21
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.95
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.05
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.70
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.04
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.14
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.48
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.64
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.38
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.61
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.48
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.47
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	151.00
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	146.30
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	142.73
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	141.66
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	130.63
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	126.85
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	125.89
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	125.75
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	125.11
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	124.62
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	120.75
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	120.43
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	118.50
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	116.35
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	115.59
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	115.50
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	113.00
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	111.87
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	110.34
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	106.41
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	104.68
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	101.45
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	97.57
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	96.81
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	85.24
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	75.95
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	63.23
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	58.38
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.40
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.53
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.22
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.49
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.65
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.77
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.35
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.45
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.78
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.98

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.