Gene detail

Detailed information of XP_074629861.1 in Acropora palmata

Genomic Location: NC_133889.1:17770716...17781468
NR annotation: XP_029197720.2, zinc finger FYVE domain-containing protein 1-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074629861.1

ATGGCTGCCATACTGCCCAATAGCAAAGATGTCAGTGACCCTTTACGCCACGATCAACGTGTGAAAAAATCGTCGACCCTAAAGGATTCTGAACACATATCTGAGGAAACTATATCGGTACGCTCCGCGAAAATTGAGGACTCAAGTATGACTGAGGACGATCAAAGAAGCTTCTTGCTGATGGACGAAAGAGAAAATCTTCAGGTAGGCAGTGTGGAAGAGTTTGTGACAAGGCTTTCATGTCCAGGAGAAACAAGCATGAAAGTTGTCTGTATATTTGGAAATACAGGTGATGGAAAGTCTCACACACTAAACCACACATTCTTTGAGGGCGCAGAAGTGTTTGCAACATCGTCATCTCAAGTGTCTTGCACAGTCGGTGTGTGGGCTGCCTATGATGCAGTCAATCATGTCGTTATCTTGGATACTGAGGGACTTTTGGGTGTGTCAGGAAACCAGAATCGGCGAACAAGGCTATTGCTCAAAGTTCTTGCAATATCTGACATAATCATCTACAGGACAAGAGCTGAAAGGCTTCACACAGACATGTTCACTTTTCTTGGCGATGCATCTGGTGCATATCTCAAGCATTTTACAAAGGAATTGAAGCATGCGACTGAAAGGTGCCACATGGATGTGCCATTGTGCACCTTGGGACCTGCAGTGATTATCTTTCATGAAACCCAGCACACTCATTTGCTGGGGTTTTCTCAAAGTCAATCCTCAGAAACTGTGATTACAAAATGTCCTGATGAAATTTTAAGGGAGAGGTTTTCAGATGTTGGTAGGTTTCCTCATGCTTTCAGCTCCATCAAGTATGTTGGCACAAGAACTTTGTCCCCACCCACTGATTTCTCAGAATTGAAGAAGGCTGTCACAGATGGTCTGACCACCAGCTCAGTCCGTTCACGGCGCTCGCCTGCTGTCATATATAAAGCACTGATGCTCCTGAATGAGAAATTCAGTAACAACATTGAAAGGACAGTACCAAATACCTTCCCTGATGCATATTTTACCTGTCAGGCAGTGTGTCTTTCATGCAGTGCAAGATGTCAAAGGAGTATGAATCACGAAAAAGACGAATCAACAGATCATATGAATGACAGCAGGTGTCACTATCAAGCTCGATTTGACAACAGAATATACACATGTAGGGCTTGTTATGACAGAGGAAAGCAAGTGGTTGTTGTTCCCAAAATGTGTTCATCAAATGATTCTTCATGGCTTGGCTTTGCCAAATATGCATGGTCTGGGTATGTCCTCGAATGTGTCAAGTGTGGTATCATTTATCGCAGCCGTCAGTTCTGGTATGGCAACGAGGACCCAATCAAAACAGTCGTCAGGACCGAGCTTTGTCATGCATGGCCTGGGGAAATTTTGGGTCCGTTGGACAGTGGGAACGCGGCGCGCCGCCTTTTGGATAACGTCGGTTACGTGACAGATGCGGTCAGCAGTCTTAGTATTCCTTCAAGTAAAGTAGTGACAAACTGGATCACCGACAAAGTGGCTCCAGATTATTGGGTTCCCAACTCGAAAATTACAGCATGCCAGTCGTGTGGTCACGTGTTTGCTGATGTAGAGACCAAGCACCACTGCCGCGCTTGTGGCCGTGGAGTTTGCGGTGCATGTTCAACCAATAAGAAACCTGTACCAGAGCGAGGCTGGGGTGAGATACCTGTGCGAGTCTGTGATCGCTGCTTTGGAAAGTCGCCAGCAATTGAAGAGCAGCCGCAAGCGATTCTTAACTTGAGCGATTTGTCCGACGCGCTTGTCGAAGAATCACCGGAGGAAATAGCCAACACCGAGCGAGCCCAAGTCCAGATTTCTGATCATCCAATTGGCCCCGTAGCTGCTCGGAAAGTCACCGAAGTCGTCCAATCAGCTGTTGGAATTCTAAAAACTGCGATTGACTATCCCAAGGTTTTGATCACTGATGCGGCCAGGCCTGGTTACTGGGTGCCAGACTCCGAGATTTTGGAATGTGTTTGCTGCAAGACCGAGTTCAAAGAAACTGATACTAAACATCACTGCCGTGCTTGTGGGATGGGCGTGTGTGGTAACTGCTCGGAAAGTAGGACGTCTGTGCCAACAAGGGGATGGGACCATCCGGTCAGAATTTGTGATCTGTGCGTGGCAAAAATAGGGGGTCTTAAGATAACTTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9HBF4	Zinc finger FYVE domain-containing protein 1 OS=Homo sapiens OX=9606 GN=ZFYVE1 PE=1 SV=1
Q810J8	Zinc finger FYVE domain-containing protein 1 OS=Mus musculus OX=10090 GN=Zfyve1 PE=1 SV=2
Q5RFL4	Zinc finger FYVE domain-containing protein 1 OS=Pongo abelii OX=9601 GN=ZFYVE1 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005995 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01363 all species →	FYVE	FYVE zinc finger	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR006058 all species →	Binding_site	2Fe-2S ferredoxin, iron-sulphur binding site	Interproscan
IPR017455 all species →	Domain	Zinc finger, FYVE-related	Interproscan
IPR000306 all species →	Domain	FYVE zinc finger	Interproscan
IPR042427 all species →	Family	Zinc finger FYVE domain-containing protein 1	Interproscan
IPR011011 all species →	Homologous_superfamily	Zinc finger, FYVE/PHD-type	Interproscan
IPR013083 all species →	Homologous_superfamily	Zinc finger, RING/FYVE/PHD-type	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46624 all species →	AGAP002036-PA	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0051537 all species →	Molecular Function	2 iron, 2 sulfur cluster binding	Interproscan
GO:0046872 all species →	Molecular Function	metal ion binding	Interproscan
GO:0005545 all species →	Molecular Function	1-phosphatidylinositol binding	Interproscan
GO:0005547 all species →	Molecular Function	phosphatidylinositol-3,4,5-trisphosphate binding	Interproscan
GO:0005811 all species →	Cellular Component	lipid droplet	Interproscan
GO:0032266 all species →	Molecular Function	phosphatidylinositol-3-phosphate binding	Interproscan
GO:0043325 all species →	Molecular Function	phosphatidylinositol-3,4-bisphosphate binding	Interproscan
GO:0140042 all species →	Biological Process	lipid droplet formation	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K17603	ZFYVE1; zinc finger FYVE domain-containing protein 1	-	Mitochondrial biogenesis	ko03029	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074629861.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

69TPM > 0

2Conditions

40.0Max TPM

19.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	37	17.08	32.00
all_coral_tissue · baseline	38	32	21.40	39.99

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.00
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.34
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.92
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.22
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.91
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.65
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.55
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.28
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.18
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.66
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.34
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.74
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.06
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.12
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.09
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.76
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.73
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.41
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.01
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.99
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.35
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.66
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.33
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.86
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.25
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.06
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.74
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.00
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.77
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.53
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.23
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.68
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.00
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.50
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.22
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.11
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.48
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	39.99
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	38.51
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.84
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.83
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.52
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.49
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.29
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.22
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.89
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.73
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.38
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.31
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.23
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.22
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.36
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.62
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.94
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.62
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.17
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.98
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.57
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.30
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.59
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.75
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.90
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.05
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.62
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.50
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.45
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.43
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.40
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.34
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.