Gene detail

Detailed information of XP_074630236.1 in Acropora palmata

Genomic Location: NC_133889.1:2057201...2082528
NR annotation: XP_029197445.1, protein Smaug homolog 2-like isoform X3 [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074630236.1

ATGACTTCTGCTTATTTCAATCGTCCGGATATTCCTTTGACTAATCACAGAACCCATAAAAGTGGTTCGAATGCTCGCCTGGGACCAAGAAGACCATGGACAAGGGATTTGTCTTCATCGAGCGATATGAGGCCTGCCCATCACACGCTCTTTCGGGACCAAGTTAGCACCTTGGTGGAGTGGTTTTCCCACTGGAATGATTGTGAACGAACCATCGCGCTGTACACACTACTAATGAGAATTTCCACAATACAGGCAAAATTTTTGTCGTTAATCCTGGAGCACACCTATCGCGAGGATTCTTACGAAGTTCAGGTGATGCAAAAGCGTGCTAACGACAAAGATTTTGTGAGGAATTTAATGTATGAAACTAAAGAAGCAGCTGTCAAAAAGCTCCTAACACATTTGCCACTCCTGAATCCAAGAAATGATGAGGCGAGATACGAGTACCTTCATCTACTTCCAAAAATTCTGCATCACTCTGTGGAGCACTCTGTTCATCAAGAAGAATGTCGACAGCTTTTGTCACTTGCTGTAGTTCATCCTGCATTCCCCCCTGAAGAGAGAAATACACTGCACCACTGGCTGAGTCAACTTGATAGGAGTCTTGGTTTCCAAGAAAGGCAACAAGCTACAAATTTTATGACGGAGAATCCAGATGTACGGCCAAACACAGGGTGTGAAAACCTTGTTCGACAAAACTACAGACGAAGGATGAATGGATGGCGCAATCAACAACCACTTGTTCATGGCGACTCTGGATTTGGTGGTTCGTTTGAATCTCCACCAACCCATCTGTCAGTTTCACCGTCTCCGAGGAAAGCCAGGTCAAATTCGCTCACCCCTCCCCCACCGGGGAAAGGTCGTGAATCTAGTTTGGATGATCATTTAGGGAAGAAAGAAATTGAGAATCGTCCGGGCAGGTCCCAGTCATTTCCAGTCGATCCTCAAACAGTAGCAAGTCACTCAATGTCACCTCAGTCGTCTGTGGAAAGTGAAGTGGATGAAAATTTGCCCGTTCAGAGAGGCAGTAGTTTCTCTGAAAATACAAATCCAGGAATGAAAGGTATAGGACTCTGGTTAAAGCATCACAGATTGCACAAGTATACAAGCCTATTTTCAAACCTTACTTATGAAGATATGTTAAATCTCACATCAGAGATTTTGGAAACTAAGGATATCACCGCAGGAGCAAGAAAGAAGATTTTGTTGAACATTAATAAAATATCAGATAGAGGAGAGATATTGTCCAGATTGGAAAAGGATGTGCTTGTGCCTGGTAAACTAGAGGAGGTCTTGAGTGCATTGAAAGAACTAATTGTTATGCCTTTGAAACCATTTGACCCACCCCTCCCTGAAGCTTCTGCTCAAGCTTCCCATCACTCTAAAGGTCAGATTTCACAAAGGCTGCCTCCACTTCACCCAGATGATATGCCATCACGCATTGCAAGAGTCCTTGGTAGAGCTTGCACCCAAATTCTAGTGACAAGAGTTAATGAACTGGAATGCTGTAACTTTTACATTCAACTTTTGGATTCAGCTCTAAATCTTGAGGCGTATACCCCAGCTCACAAGGCGAGATTTCAGTCATGGAGAAAGGAATGTCTGAAACTCGTAAAACAACTACGCTGGCACTCGCATGATAATCATCCAAGAGGGTGGTACCATCATTCTGGAGACTCCAGTGGGCTTCCTGCAGGTTCAGGGGGACATAATTCTGGTGACTCTTCAGGTGGTGCTGCTGGTCCATCTGCAGGCTCAGGTGGACCAGGCTCGCATTACCGAGGCTCATCTCGTTATTCTGCTAACAATCACTCCAGCCAGCTTCGAACTAGTAACAGTGCTGAATCACAGATGCAGCATAAACCACGACTGGTAAGAGCGCATGCTGTCGTGGGCAGGACAAAGTCCCTTCCAATTGAACCAACACAACCACCAAGAGTTGCATTACCACCACAACTTTCAGCTGATCGTGAAAATATTGATGCTGGTCTGGAATCTCTTTGTATCAGTGTAACAGAACATGCTTTGTCAGATTCCAAAGAAGATTGTGTGGGTTACAGTAGTTATTACAAACAATAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5PRF9	Protein Smaug homolog 2 OS=Homo sapiens OX=9606 GN=SAMD4B PE=1 SV=1
Q80XS6	Protein Smaug homolog 2 OS=Mus musculus OX=10090 GN=Samd4b PE=1 SV=1
Q8CBY1	Protein Smaug homolog 1 OS=Mus musculus OX=10090 GN=Samd4a PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003139 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00536 all species →	SAM_1	SAM domain (Sterile alpha motif)	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR050897 all species →	Family	SMAUG/VTS1 RNA-binding	Interproscan
IPR013761 all species →	Homologous_superfamily	Sterile alpha motif/pointed domain superfamily	Interproscan
IPR001660 all species →	Domain	Sterile alpha motif domain	Interproscan
IPR037093 all species →	Homologous_superfamily	Smaug, PHAT domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12515 all species →	STERILE ALPHA MOTIF DOMAIN CONTAINING PROTEIN 4-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000289 all species →	Biological Process	nuclear-transcribed mRNA poly(A) tail shortening	Interproscan
GO:0000932 all species →	Cellular Component	P-body	Interproscan
GO:0003729 all species →	Molecular Function	mRNA binding	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0017148 all species →	Biological Process	negative regulation of translation	Interproscan
GO:0030371 all species →	Molecular Function	translation repressor activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K27396	SMG; protein Smaug	-	Messenger RNA biogenesis	ko03019	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074630236.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

81TPM > 0

2Conditions

92.9Max TPM

30.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	46	35.69	92.92
all_coral_tissue · baseline	38	35	25.08	41.94

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	92.92
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	71.68
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	71.24
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	63.16
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	62.33
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	60.46
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	55.84
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	55.08
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	48.09
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	47.99
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	47.83
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	45.32
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	44.87
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	42.16
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	40.44
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	40.23
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	39.48
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	37.29
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.60
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.93
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.51
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.31
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.57
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.46
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.00
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.24
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.49
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.35
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.34
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.99
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.40
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.56
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.48
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.33
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.06
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.70
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.48
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.14
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.67
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.57
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.37
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.27
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.84
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.55
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.54
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.36
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	41.94
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	41.42
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	37.25
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.66
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.21
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.96
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.28
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.00
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.89
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.81
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.48
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.20
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.26
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.81
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.64
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.68
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.60
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.86
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.28
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.22
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.46
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.39
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.21
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.23
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.87
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.22
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.53
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.29
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.81
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.24
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.91
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.66
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.17
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.98
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.62
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.