Gene detail

Detailed information of XP_074630293.1 in Acropora palmata

Genomic Location: NC_133889.1:1154329...1160104
NR annotation: XP_029189594.2, LOW QUALITY PROTEIN: protein-glucosylgalactosylhydroxylysine glucosidase-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074630293.1

ATGGCGGCAGGAACTGCGACTCGTTTCATCACAGATACACTACCCATAGATCATAACGGGGTTACAGTTCGTCAGAGTAGAAATGGCACCTATATGCCCTCAGTTGCGAATGGATATCTTGGAACAGTGATTTACAGTGATACAGTGCATGTGTCGGGAGTCTATAATGGAAAGGCCTGTCCGAAGAAGAATCCGATTTACCCAGTTTATTTGAAACAACATACTCACCGAGCCAGGGTCCCTTCTACCGCTGCTATTGACTTCAGTGTCTCCGGAATCCAGGGTAAAACATCATACGCCTTGGATGTGCAAGAAGCTGTGTTTTATAAATGGTTCAGAGCTGAAAATTTGCAAGTGGAGCAGAGAATATATGCACATCAATCTCGAAAGAACTTACTGATTGTTGAGATTGCTGCAAGGAACACAGCGAACAGAGAGTTCTTGATGAGTGTTTCTCTGAATCGTGGAGATGCCTCAGATGATTTCCAGTTTCAGACGATCGATTCAAATAGGACCGGAGCATCAGCTGCGATTGCCAAGGTAAACGAGACAGAAGAGGAGGGAAGTATGCAAGTCAATTTAGCCACAGTTTGGTCTAAGCTTGAAGATGACGGCGAAACACTGACGATTAAGAGATCTTCTGAGGAACAGTCATGGATTTACATCACCTCCATAGCAACCAATTTGGATACCAAATTCAACCCCCTCTCCGAGGCTCTCCAACAGTGGGATGAGGCTGTGTTAACCAAAGATCAGCTTCTTACTGAACACAAGGCCGCTTGGAAGGCATTATGGGACACTGGCCGGATAGAAATTGAAGGCAACTTGAAAATGGCGCAAGCGGTTTACAGCAGCCTGTACTACATTCTAAGCTCCACTCGGCACGACTGGCCGTACGGGTTAAGTCCTGGGGGAATACCAGCTGCGGAGGAATACATGGGGCACACATTCTGGGATCAGGATATTTGGATGTTCCCGCCTCTTGTTCTAATGCACCCGAAACTGGCAAGGAATTCCCTGAAATACCGCAAAGATAGGTTACCTGCAGCGCGCAGAATCGCCAAGGAGTACGGTTACAAGGGTGCCATGTTTCCTTGGGAAAGTTCCTTGACGGGCCTGGAGACTTCCCCAGGTGAGAGGTACGGACGAGCTCAGATCCACATTACAGGAGACATTGCTTTTGCTGCTAAACAATTCTGGAGAGCTAGCAAGGACGTCAACTGGCTGCAGGAAATTGGGTATCCGCTGGTATACGAGACCGCGGAGTACTGGGCGAGCAGAGTGGAATACGATGTTGCAAGTGACCGTTACGTCATTAATCACGTGATGTCACCTGATGAATATCACTACCCAGTTAATAACTCAGTGTATACAAATGTAGTGGCAAAAATAAATCTTTTATTTGCCAAAGAGGCAGCAACAGCTTTAGGAAGGGAATCTCCCCAGGAGTGGTCAACAATTGCTGAAAAGTTGGTTATACCATTCGACAGCGAGAACAATTTTCACCCGGAATACGAAGGTTACACGTTAGACAAGGAAGTCAAACAAGCAGACGCAATTTTAATTGGTTACCCATTAATGTATGAAATGGATAAACAGGTTCGTTACAACGATTTGAAGCTGTATGAAGAACGCACGGACCCAGATGGTCCCGCCATGACACACTCCATGTTTGCTATAGGATGGCTGGACATCGGAGACAAAAAACGAGCTGAGAGGCCGTTCGTAAAAAATTACGCCAATATCCGTGGTCCATTCAAGGTGTGGACAGAGCGCCGTGACTCCTGGGGCGCGGTAAACTTCATCACCGGAGCTGGTGGATTTCTGCAAGCTGTAATCTATGGCTATGGAGGATTCCGACTCCAGGATTCTGAGCTGGCTTTTAATCCAACTTTACCACCGAAAGTCACAAAAATGTCAATCAGGTTGAATTTTCTTGGGAGTTGTATGGATTTTGTGATCAGTGAAAGAAACTTAACAATCACAGTAGTATTTGCTAGTCCAATAGCACCCCCCTTAGAGGTCTCAACGGGGGAAGGGGTGCAGAATTTGGAGCGTTTTGAACCTGTCACTTTTAGCAGGGGTCGTGGTGCTGTGCGCATGTCACAATGTAACCGAACCATCAGCAGAAAGTCGTGTGCATGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
F1NZI4	Protein-glucosylgalactosylhydroxylysine glucosidase OS=Gallus gallus OX=9031 GN=PGGHG PE=1 SV=3
Q8BP56	Protein-glucosylgalactosylhydroxylysine glucosidase OS=Mus musculus OX=10090 GN=Pgghg PE=1 SV=1
Q32M88	Protein-glucosylgalactosylhydroxylysine glucosidase OS=Homo sapiens OX=9606 GN=PGGHG PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001492 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF03632 all species →	Glyco_hydro_65m	Glycosyl hydrolase family 65 central catalytic domain	Repeat	Interproscan
PF03633 all species →	Glyco_hydro_65C	Glycosyl hydrolase family 65, C-terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR005195 all species →	Domain	Glycoside hydrolase, family 65, central catalytic	Interproscan
IPR008928 all species →	Homologous_superfamily	Six-hairpin glycosidase superfamily	Interproscan
IPR012341 all species →	Homologous_superfamily	Six-hairpin glycosidase-like superfamily	Interproscan
IPR005194 all species →	Domain	Glycoside hydrolase family 65, C-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11051 all species →	GLYCOSYL HYDROLASE-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003824 all species →	Molecular Function	catalytic activity	Interproscan
GO:0005975 all species →	Biological Process	carbohydrate metabolic process	Interproscan
GO:0004553 all species →	Molecular Function	hydrolase activity, hydrolyzing O-glycosyl compounds	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K22078	PGGHG, ATHL1; protein-glucosylgalactosylhydroxylysine glucosidase	EC:3.2.1.107	Enzymes with EC numbers	-	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074630293.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

55TPM > 0

2Conditions

11.7Max TPM

4.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	28	3.35	9.98
all_coral_tissue · baseline	38	27	5.19	11.73

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.98
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.11
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.69
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.55
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.37
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.30
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.30
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.79
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.64
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.44
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.43
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.00
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.95
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.29
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.28
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.16
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.06
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.34
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.31
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.08
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.08
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.71
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.70
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.32
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.12
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.98
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.76
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.49
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.73
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.77
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.48
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.02
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.86
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.59
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.47
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.46
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.08
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.06
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.02
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.78
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.57
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.31
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.14
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.10
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.68
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.60
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.43
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.12
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.68
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.41
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.36
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.22
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.04
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.95
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.34
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.