Gene detail

Detailed information of XP_074630451.1 in Acropora palmata

Genomic Location: NC_133889.1:1047608...1050272
NR annotation: XP_015778996.1, PREDICTED: DNA polymerase kappa-like [Acropora digitifera]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074630451.1

ATGGCGGGCAACGGCTTCAATTTTCTGCACGACGAAACCTATGCGGATTCAGAAGTTTTAGAACAAGACGACGACGAACTTGGTGATTGGAGTGAAATATTCAATGCACCCGAAATGGATTGGGAACATTCGGAGGGTAATGAATACAGGTATGACCCATCAAAGGACAGAGGAGATTCTGGGAAAGAAAACAACGTCATCGAAGGACATCAAATTGTTGCTGAGAAAGACGAAACGAAGGATGAAGACAACGCTCAAGGCCTGACAAGAATGGAGTTGAATGATCATAAAGCAGGAATGGTGGGTCTTGATAAGGAAAAAATCAATCAAATCATATTTGAAGCAAGCAAAGGTTCTAGATTTTATGAGAATGAAATGAAGAAGGAAAAACAAGTGGCAGAAAGAATAAGAAAACAAAGCATCTCCCTCAAAAGTATCACAGAGAAACAGAGACATGAAGCATTGGAAGTCACTGACCAAATCGTAAAAGAACTTGAGAGAAGTCGTGATTTAAGCCGAACCTTCGTTCATATTGATATGGATGCGTTTTATGCAGCAGTTGAAATCTTGGATAACCCTGCATTGCGTGACAAACCGATGGCTGTTGGTGGTAACGCAATGCTGTCAACGTCGAACTATCCAGCCAGGCGTTACGGCGTTAGAGCAGCTATGCCAGGGTTCATAGCTAAGAAGTTATGTCCTGATCTGGTCATTGTTCCCCCTCACTTTGACAAATACAAGGCTTATAGTCGACAAGTTCAGGAAGTCTTAGTCGAGTATGATCCAGACTTTGCAATGGCCAGTTTAGATGAAGCATACTTGGATCTGACTGAATATCTGAGAGAGAGGCAGAAAGGCAAAGAGAAAAGAGTCATAGAACAACAATCGGATTCCAATGAACATAGTGGTAAAACGACAGCTATAACTTTTCAATTTGGAAATGACGCCGAAGAGGTCGTGAATGAACTTCGCTTAAGAATTGAACAGAAAACTCGACTTACTGCAAGCGCTGGGATCGCTCCAAATCTCTTGCTGGCTAAGGTCTGTTCAGATCGTAACAAACCCAATGGACAATTTATGCTGAAGCCAGATCACCAGGTTGTGTTGGATTTTGTGCAAGAACTTCCAATTAGGAAAATAAGTGGAATTGGCAGAGTTAGTGAACAGATGCTCAAAGCTCTAGGAATAGAGACCTGTCGTGATCTGTACACGAAGCGAGACCTTCTCTATCTCTTGCATTCTCCTATAAGCTTTAGATTCTTAATACGAGTTTCTCTTGGCCTGGGAAACGCTTCCATAGGTACTGATCCCAAAAGAAAAAGCATTGGAACGGAAGTGACATTTTCAGAGATGAGCAAACCAGATGAGTTAATGGAAATGTGTACTAATCTATGCCAGTCAGTGGCAGAAGATATGAAAAAGCAGAAACTTAAAGGAAAGACTGTCACAATAAAGCTAAAGACTGTTAACTTTGAAGTGAAATCACGTTCTCTATCTTCACTGAATCCCGTTTCAACCTACGAAGAAATTTCTTCCGCTGCAAAAGAGCTCCTCAAACATGAAATAAAGGCATGCTCTCCTGACCCTCTTAAACTTCGTCTTATGGGAGTTCGTCTGTCGAATTTAATCGACAATTTTTCGGATTCTTCAAAAGAAGGCAGACAGAACACAATTAAAGGGTTTCTGAAACCAAAGAAAAACGTTTTGAGTGAAGAAGTGCTATGTACTGAGCTTTCGAAGGAGTGTGATGCACATGTTGAGCTTTGTACTGAAAAGATGTCAGGTAAGGACAAGTTTACTGAAAATGTCAGCTCGGAGGTCGTTCCAACATCTTTCTCCTCAGAAGCAGAAAATGACTCGTGTTATTTGGACTCTTGTTCTATGGGTTTCGTTGAAGGAAAATCTTCAAGCGAGCCTTCATGCGGATCTGTCTTAGAGTGTCCGGTTTGCGGACAAAATCAAATGATGAAACCAGGAGAAGATGCAATTACGGGGCTAAACAAACACATTGACTTATGCTTGAATAAGTCGACCATTAGGGAGATGGTGTCAGAGACCAATTCCAATCACACTGGAGTGGATTCTATCTGCGCTTCTGATAAACTTAGAATTATCGAGAAGCCCACGAAGACTAACAGAGGAAAAAGGAAACGACAGCAAACTGGAACAACAGTTTCGAAGAAAGCAACACTGCATTCGTTCTGGTCCCATTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9UBT6	DNA polymerase kappa OS=Homo sapiens OX=9606 GN=POLK PE=1 SV=1
Q9QUG2	DNA polymerase kappa OS=Mus musculus OX=10090 GN=Polk PE=1 SV=1
P34409	DNA polymerase kappa OS=Caenorhabditis elegans OX=6239 GN=polk-1 PE=3 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0006695 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF11799 all species →	IMS_C	impB/mucB/samB family C-terminal domain	Domain	Interproscan
PF00817 all species →	IMS	impB/mucB/samB family	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001126 all species →	Domain	UmuC domain	Interproscan
IPR036775 all species →	Homologous_superfamily	DNA polymerase, Y-family, little finger domain superfamily	Interproscan
IPR022880 all species →	Family	DNA polymerase IV	Interproscan
IPR043128 all species →	Homologous_superfamily	Reverse transcriptase/Diguanylate cyclase domain	Interproscan
IPR017961 all species →	Domain	DNA polymerase, Y-family, little finger domain	Interproscan
IPR050116 all species →	Family	DNA polymerase type-Y	Interproscan
IPR043502 all species →	Homologous_superfamily	DNA/RNA polymerase superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11076 all species →	DNA REPAIR POLYMERASE UMUC / TRANSFERASE FAMILY MEMBER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0006281 all species →	Biological Process	DNA repair	Interproscan
GO:0003684 all species →	Molecular Function	damaged DNA binding	Interproscan
GO:0003887 all species →	Molecular Function	DNA-directed DNA polymerase activity	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0042276 all species →	Biological Process	error-prone translesion synthesis	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K03511	POLK; DNA polymerase kappa	EC:2.7.7.7	DNA repair and recombination proteins	ko03400	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074630451.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

76TPM > 0

2Conditions

8.3Max TPM

2.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	41	2.06	8.32
all_coral_tissue · baseline	38	35	3.70	7.77

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.32
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.58
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.41
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.57
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.30
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.92
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.82
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.49
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.32
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.85
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.69
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.65
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.51
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.42
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.23
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.22
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.03
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.00
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.99
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.88
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.74
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.72
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.64
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.61
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.59
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.58
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.51
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.43
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.39
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.31
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.29
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.24
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.20
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.07
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.07
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.06
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.04
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.00
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.77
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.70
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.55
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.77
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.40
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.27
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.44
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.38
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.05
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.68
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.59
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.37
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.33
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.20
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.02
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.47
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.45
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.30
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.95
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.90
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.85
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.65
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.39
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.24
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.02
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	2.99
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	2.88
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	2.73
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	2.42
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	2.26
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1.86
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1.75
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1.66
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1.12
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1.11
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1.09
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1.08
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.