Gene detail

Detailed information of XP_074631471.1 in Acropora palmata

Genomic Location: NC_133889.1:19803673...19825521
NR annotation: XP_029203084.2, calpain-9-like isoform X1 [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074631471.1

ATGCCTCGAAAACAGTGGTACGAAGATCTCAACGAGATCAAACGAAGATGCAGGGGTGGTCAGTTGTTCGAGGATCCCGAATTTCCAACGATTGACAGCAAAGTTTTCAAGAAGCGTGTGCTTCCTGGAGGACAGTCGTTTGAATGGCTTCGTCCGCAAGAACTGCTGGACAGACAAGAGGTAAAAGAAAAGGCGCAGCTTTTGGTGGGCGGGGCATCACGTCTAGACATCAACCAGGGTATGTTGGGGGATTGCTGGTTTCTTGCAGCAGTTGCATCCTTAACTCAAGAGGAAAAGTTGATAAACAGAGTTCTGTGCCTTGATGACAATGCAGACTTTGGAAGCTCCAATTATTGTGGTGCTCTGAAATTCAATATCTGGCAAGACGGAGAGTGGACTGAGGTGGTTATCGATGACCGTCTACCAACATACCGCAACAAGCTAGTCTTCATGCACTCAAAGGAGAAGAATGAATTTTGGAGTGCCCTTTTGGAAAAGGCCTATGCAAAACTTCAAGGCTCTTACGAGGCTCTCAAAGGGGGTCAAACAATAGAGGCTATGGAGGATTTCACAGGTGGCTTAGGCGAGGACTTTGACATGAAGAAGATGCGAGATGGAATGAGAGATTATCAGAAGAGAGAGGAATGTGAAAAACAGAAAAAGGAACTCTTTCCAATAATACAGAAAGGCTTGAGACGTGATGACCTTATGGGTTGCTCAATCACGGCAGCGCCCAATCAGGTAGAAGCTAAAGGTGACCTTGGACTGGTGAAAGGGCATGCTTACTCTGTAACAGGAGCTACCTGTGTAAATGTCCATGGAGAAGAGGTGCAGTTGGTCCGTGTGAGGAATCCTTGGGGGAACGAAAGAGAATGGGAAGGAGCTTGGGGTGACAAGTCCAGTGAGTGGAGACAGTTGTCTGAGAGTGAGAAGCGAAGAGTCAATCTACAGTTTGATGATGATGGAGAGTTTTGGATGTCCTTTGAAGATTTCTTCAAGTACTTTGACAAATTGGAGATTTGTCACTTGGGACCTGATAGTGCCAGAAAAGGAGGTGGTCAAGCCAATAATTGGGAAGGACGCACTGAAAAGGGTGCTTGGATCAGGGGTTCTTCAGCTGGAGGATGCCGTAACTTTTTGAATACCTTTGCCATGAACCCACAGTTTAGAGTTGATTTGCAAGATGCCGATGATGATGCCGATGACAAGTGCTCCTTGACAGTGGCCCTTATGCAGACTAAGCGCCGCAAATTGAAAGCAGAAGAAGGGAAGCCTATGTTGACCATAGGCTTCTCCATTTACAAAGTCACTGATGAGGATTTGAAAACTGGAAGGGCTGAGAGAGACTACTTTGCTTATCATGCTTCCACTGCTCGCTCACCAGTCTTCATCAACAGTCGTGAGGTGACTGGCCGTTATATGCTGGACCCTGGCTCATACTTGATTATTCCAACCACATTTGAACCAGGTCACCAGGGTGAATTTATTGTGCGTATCTTCGCAGAAAAGCCAGTGACCACAGGCAAAGTTGATGTCAAGACTTCCATCCATTCCAGAGAGGACCGCAAATCTAAGTACGTTTCCAATAGTAAGGAAGAGAATGAAGCCGTGGATGCATCTTTCAAGCAACTGTTCATGAAACTGGCTGGAGCTGACAGAGAGATTGATGCATTTGAACTTCAACAGATATTGACAACAGCTACCAAGAAGGTGATGGGTGGTAAAGAGTTTAGTTTAGAAGCCTGCAGGAGCATTATAGATCTCAAGGATGATGAAAAGACTGGAAAGCTTGAATATGAAGAATTCAAAGAAGTGTGGGCAATGGTGAAAGAGTTGCTGGTAACTTTCTCGAAATATGACACGGATAAAAGTGGGAACATGGACATGTACGAATTGCGCCTTGTGCTTAAGAGCGAAGGCCTGTCGTTGCCCCAGCCGATTTTGGACTCCATTGCTGCTCGCTTCAACAACAAGGAAGGAAAGTTGAACTTCGACGATTTCTTGCAGATTATTTGCCGAATTTATTCGCTGAAAGATACTTTTGATAAACACCTGGAGAGAGGTGGAAAAGCAAGTTTCACCTTGGATGAGTATCTCAGAGGAGCTTTAACTTTATAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O35920	Calpain-9 OS=Rattus norvegicus OX=10116 GN=Capn9 PE=2 SV=2
Q9D805	Calpain-9 OS=Mus musculus OX=10090 GN=Capn9 PE=2 SV=2
Q9VT65	Calpain-B OS=Drosophila melanogaster OX=7227 GN=CalpB PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000851 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00648 all species →	Peptidase_C2	Calpain family cysteine protease	Family	Interproscan
PF01067 all species →	Calpain_III	Calpain large subunit, domain III	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR038765 all species →	Homologous_superfamily	Papain-like cysteine peptidase superfamily	Interproscan
IPR036213 all species →	Homologous_superfamily	Calpain large subunit, domain III superfamily	Interproscan
IPR001300 all species →	Domain	Peptidase C2, calpain, catalytic domain	Interproscan
IPR000169 all species →	Active_site	Cysteine peptidase, cysteine active site	Interproscan
IPR022684 all species →	Family	Peptidase C2, calpain family	Interproscan
IPR002048 all species →	Domain	EF-hand domain	Interproscan
IPR050420 all species →	Family	Calpain	Interproscan
IPR033883 all species →	Domain	Calpain subdomain III	Interproscan
IPR022682 all species →	Domain	Peptidase C2, calpain, large subunit, domain III	Interproscan
IPR022683 all species →	Domain	Peptidase C2, calpain, domain III	Interproscan
IPR011992 all species →	Homologous_superfamily	EF-hand domain pair	Interproscan
IPR018247 all species →	Binding_site	EF-Hand 1, calcium-binding site	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10183 all species →	CALPAIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004198 all species →	Molecular Function	calcium-dependent cysteine-type endopeptidase activity	Interproscan
GO:0006508 all species →	Biological Process	proteolysis	Interproscan
GO:0005509 all species →	Molecular Function	calcium ion binding	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for XP_074631471.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074631471.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

84TPM > 0

2Conditions

2,679.3Max TPM

913.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	46	947.50	2,679.27
all_coral_tissue · baseline	38	38	872.17	1,504.82

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2,679.27
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1,693.27
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1,649.08
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1,518.68
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1,471.23
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1,454.98
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1,440.83
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1,433.57
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1,422.57
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1,410.29
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1,328.69
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1,295.69
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1,281.09
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1,266.01
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1,261.54
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1,176.05
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1,123.46
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1,093.55
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1,085.91
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1,035.24
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1,033.04
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1,018.96
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1,002.37
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	996.34
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	920.99
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	714.22
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	634.68
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	626.07
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	622.36
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	616.58
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	566.33
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	558.74
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	536.83
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	521.09
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	496.85
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	484.39
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	482.59
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	460.08
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	459.17
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	429.65
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	425.05
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	415.12
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	409.54
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	388.83
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	332.24
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	311.75
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1,504.82
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1,396.21
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1,385.47
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1,384.76
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1,273.39
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1,174.41
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1,159.40
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1,141.20
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1,124.07
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1,119.82
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1,060.60
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	988.25
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	975.22
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	958.94
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	938.92
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	937.36
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	930.17
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	919.16
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	913.26
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	910.06
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	895.44
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	842.84
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	833.55
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	770.75
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	724.83
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	710.06
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	707.43
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	649.12
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	617.41
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	608.65
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	602.46
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	501.77
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	500.11
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	475.70
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	474.91
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	380.20
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	329.53
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	322.38

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.