Gene detail

Detailed information of XP_074632099.1 in Acropora palmata

Genomic Location: NC_133889.1:21903243...21916972
NR annotation: XP_044163615.1, WD repeat-containing protein 27-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074632099.1

ATGGCGGCAAGTCATGGAGGTTTGCTTCATGTATCTTCATCTCCAGGGCAACTGCAGATGTCATGCACAAGCGCTTTCCTTGCCTTACCTTTGACCAAAACTATTGTAGGCGTGTGGTGGCTTGAAGGCTTGTCAAAAAAGCCTTTGCAGTTATCAGGCCACAGCAGGGTGGTCAGTGCAACTTGCTTTGGACACCAAGACAGGCCCCTTCTATTGTGCACTGCCTCAGATGATTTCATATTTCTTTGGAATATAAGCAAACTTCTGTCCCTTGAAAAAACGAGTGATCACAGCAGTGGCGTAGCTGTTGCTAAAGACCTAGGAAATGTGCAACACATCAGTTTCAGCTCAACAGACAAGTTGATTACAGCATGTATCGGGAAAGAAGTGTGGGTGCTCAATATCCAGACCTGCAAACTTGATTCACTGTTGGAAGGACACACTAGTCTGGTAACATGCGCAAAGTTTTGCCCAAGCAAAGAGTCAATCATCGTGTCCATAAGTGAAGATCGAACCTTCAAGGTTTGGGATATAAAGCAATCATGCTTAGTGTACCAATCAGCTATTTTGTCAGCACATCCTTTTCTCTCGCTGGCTTTTGATCCAGTTCAAAAACAAATGGCTTTTGGGGCAGCAGATGGAAAGATTCACATGTATGACCTTTCCTCGGGCAATGGGTACCGCTGCCTATTTGAGCTTGATGTGCAACAACTTCTGCAAAAATACTTAGCACAAAAGGAACTCCCTCTGGGTTCCAAAGACAAAGGACTGTCATTTATCAGTAGTCAGCCATCTTGGCAGAAAGATAGCATCAATGAAGAGTCCTTGGCGAGACTAGAACCTGGAACAGCTGTGCTTGGTATCTTCTTTATCAGGAACCCACAACAACCCACTCTGCAACAGCATGACGAGGGCATGCATGAAGTACTGTTTGAGTCAAGTAATACCGGGGCAATGAAGAATGTACTCTACGTTCCCTCCATTGTTGCCATAGCTACAACTGGAGGGGTTCTTCTTTTGAATTGTGATAGTAGAGAGCCTCTTTACATTTTGGATTTCCAAGAACCTATTTTGTCAAGTGATGAACTGGATGTGATTCAGTACAAAATATCATCACCAGGCTCATTTGCTTTTGCAGAAGGATGCAATAACACTTTGACATGTATAATTGGAAGCTTGTTCCAAAACAATGTTAATATCATCAATATCAGAGTGCCCTTCACAGACAAGCAGAGCAGTGGGAGCAATATTGAGGTGTTGTCTCAAAGACTTTTACATTCAACGGGCATCAGTTCCTATGGCAACAAAGATGAGGAGTCACAGGGACTAAGAGGAACAGAGGTTGCTTCTATTACAGTGCTGTCAAATTCGCCTCTGTGTAGCAACTCTCCACTAAAAGCAGAGCTGGTCCCGAAGACAGCGACGAAAAAGCATGAAAGGCCACTTGGAAAAGGGCGTAAACATGATGTCCGCAACCAACCGCTGACATTCCACTCCAAAGTGAAATCATCCGGCTACGCCAGCGCGCCTCCCAGGTCCAAAATGTTTTCGTCTGTCACGAAGACCACGAAGAAAGCGCCTGCAGTTTCCTTGAAAAGGCAAAGTGCCAGGACGTCTCGAAAAGAATATCCCGTTAACAGTGCAGCTATGACAAACTTGCAGCACAGGATACAGCTCACACAACAGCCTACGCCCATCAACAGTGTTGTATTTGCAGGTGATGCTAAGCATTTAGCCTGTGCATTGGCAGACAAGAGCGCACACGTGTTGGGAACTCCACCATCGAGCAAAGAAGTAGTGCTCACTGGCCACGATGGATCAGTGACATGCGTCAGCTTTAGTCGCGAGAATAACTTGCTACTGACGTCATCAAGTGATAAGACAGTAAGGCTGTGGCACCAAGCTCAGTCGGATCCTTTGATGATATTCTCTTCTGTCAGTCATAACTTTGCGTCTGAACTTGGGACCTCAGAAACCAAGCCCAAGGATAACCCTCCATTTCCCCGAGAAATCAAGCAAGCAAAGTTTTATTATGTCGACAAGTTCATTCTTTTGACATGTGGTAATGGTCTGCATATGTACAAATATTGCATTGATTTTGGAGAGAAAGATGACGTCAAAAGATACCTATCCAATAACAGGTACAAGATTGTAAAGATTTTTCAGCAGGAAAGAGCCCAACAAATAACCTGTTTCACGGCCATTAACGGATTTCATTCATATATCGTCGTGTGCTGTGGCTCCAACAAATCGATTGAAGTGTTCGACATGAACGCTGCTCGTTCTGTCCGTGTGGTACTGGACGCCCACACCAGGCCTGCTCACGCGATATGTCAAAACGAGGGTTCCATGTTCGTTTCTCACCCGGCAAGCGCTTACGATCTTTTTTTGACGGCTGCAATGACAGATGGGATAAAATTGTGGGACCTGCGCACTAACAGGCTTATCTCTACGACATTCGGGGAAATACGTTTTGTCATCGCCTCACGGGTCATACAGACGTGGTTTCTGACGTGGCATTTCATCCCGCGGAGCCGCAGCTTGTCACAGCTTCCTTGGATGGGAAGCTACGGTTTTATATGGATCACGAAATCAAGTGATAAGAGGATGCTAACAGAACGTGCACACGGAGTTAAACGCAAACATAGTGAAGTTGATAGCAACAGCCACGAGCTTCATGGCCGATGCATCCAGCGACAAACTGTGTTCAACATTTCGCTCTGCAAACTACAGAAAAGCTTTTCTCGACCCGAGCCAGTATTGTGCAGAACAGTGCTGATCTCAAATACGCTTCGTCTTATCGAGCAAGACATCAGGGAAGAGCGAAGAACTTTGGAAATGACTGTTGTTACAGATCTTAGCGACGATAAAACATTTGAGCGAGGGATCGACAACATTAGCGAACAAGTGACTTTCTCTGCACACAGTATTGGCACGCGATCATGCGAGGGATCTTCGCTTGCGAAAAGTTCCCTTACGTTCGAGCAAGAGCTAAATATCTTGGGTGATAAGATGGTAAAGGAACTTGAATTTGAAATCGACAAACCGTCAAACACTGCTGAGATGTCCGCCAAGCTAGAACTTACGGGTCAAAACACATCCCGTGCGGCTGATTTGAACAACAATACCTCGATGGCTGAAAACTCCGAGAAACTGCTTAATTTTAATACCGAAGAAATGATCAAGGAAGTAACCTGTGGGAGTCTTCTTGGGTTAGAATTAACCGAAGAACTAGAGTTTAAAGATGTAGATGTCTCACTATATGATTTTGACGTACCCAATAGCGCGTTCCCGATCGATTTTGACGAATTTTGCAGTGCTTGGAACCTCGGGACTACCAGCATTGCTGCGAAGAGTCTGCCCGCGAGATGTAGCGATAGTTTAAAGCTGGAAAGAGTAAACGAATTCGCCATTGATGAACTAGAACAAGTCATGCAGATACTAGTTGGATCTTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8C5V5	WD repeat-containing protein 27 OS=Mus musculus OX=10090 GN=Wdr27 PE=2 SV=2
A2RRH5	WD repeat-containing protein 27 OS=Homo sapiens OX=9606 GN=WDR27 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002272 (this species only) · gene tree & orthology
Ubiquitin family	UBD\|Other\|Beta-prp · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 adaptor Cullin RING\|DWD · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF06031 all species →	SERTA	SERTA motif	Motif	Interproscan
PF00400 all species →	WD40	WD domain, G-beta repeat	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan
IPR009263 all species →	Domain	SERTA domain	Interproscan
IPR001680 all species →	Repeat	WD40 repeat	Interproscan
IPR011047 all species →	Homologous_superfamily	Quinoprotein alcohol dehydrogenase-like superfamily	Interproscan
IPR042411 all species →	Family	WD repeat-containing protein 27	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR44525 all species →	WD REPEAT-CONTAINING PROTEIN 27	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for XP_074632099.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074632099.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

78TPM > 0

2Conditions

56.5Max TPM

23.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	44	25.91	56.47
all_coral_tissue · baseline	38	34	21.47	36.57

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	56.47
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	55.71
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	52.22
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	46.26
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	42.66
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	41.46
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	41.19
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	39.48
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	36.63
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.56
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.26
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.22
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.07
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.73
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.53
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.73
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.68
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.90
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.73
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.28
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.03
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.53
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.14
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.02
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.60
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.60
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.08
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.30
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.40
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.03
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.89
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.66
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.29
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.97
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.13
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.43
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.54
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.20
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.52
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.31
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.68
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.56
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.04
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.36
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.57
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.28
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.91
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.82
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.59
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.57
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.40
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.22
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.99
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.93
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.09
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.94
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.69
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.39
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.82
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.73
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.67
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.07
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.81
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.54
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.46
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.19
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.78
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.53
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.82
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.12
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.68
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.53
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.34
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.27
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.99
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.04
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.89
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.19
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.