Gene detail

Detailed information of XP_074632115.1 in Acropora palmata

Genomic Location: NC_133889.1:21919719...21935745
NR annotation: XP_029189291.1, RNA-binding protein 25-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074632115.1

ATGTCTTATCGCCCGCCACCACAACAGGCATTAGGCCATCCTCCATCTGGCTTGCGCCATCCTTCAGGTGGAATGCCGCCTGGAATGCCACCACCGGGTAATCTTCCAACGGGCATGGTACCTCCGCCGCCATTTCCCGGTCCACCAGGATTTCCCCCACCTCCTTTGCCTCCTCCTGTCGCTGCAGTTCCTCCACCAACATTGCCAAGCAAGCCACCGATTTCTGTTCCAGGGGTACCTCCTTTAGCTGTTCCTCCAGGTATACCACTTCTTCCAACACCATCATTGCCTACGTCACAACCATCATACAGAGAAACTAAGCACAGTAGTAATAATTATCAGAATCAAAATCAGGGAAACTCATCTGCAACTGCAATAACAGTGTTTGTAGGTAACATTACTGAAAGAGCCAGTGATGCACTTGTAAGACAAATCTTAACGAAATGTGGTCTTGTTGTTAACTGGAAGCGTGTACAGGGAGCCAAAGGAAAACTGCAAGCTTTTGGGTTTTGTGACTATGGAGATCCTGAAGCAAGCTTAAGAGCTATAAGGTTACTTCACAGCAAAGAATTAGGAGATAAAGCTTTAGTTGTTAAGGTTGATGCTAAAACTAAGACTTACCTTGATGAATACAAAGCTCAGAAGAAAAAAGATCATAAAAAGAAAAACGAAGATGCTAAAAAAGAAGATGGAGAAGCAGATGATGATGATGATGAGGAAAATGGCAATGATGAACTTGACGAGGAAACATTAAATGAAGACACAAAAGTAAAGAAAGCTATTGAACAAATTATTTTGGAACACTCAGATATTTTAAATCGCAAAAATGAAGCTGAACCTTATAGGCCTACACACAGTGGATCAGAGCAAAACTTGGAAGGTTTAGATATGGACACTGAAAAGAAAAGCTTGGTGTCACGGGAGATTCGTAGCTTTAGAGACACATATAGGAAAGAGGACAAGAAAAAGGAAGAAGAAAAGTCTGAGAGAAAAGAACGAGATAGAGACAGGGATAAAGAAAAAGAAAGGGACCGCGAGAAAGACAAGGACAGAGAACGTGAACGGGAACGGGAACGGGACAGAGAAAGGAAGCGGGATCGGGATGAACGAGAAAGACGTGATAAGGATCGGGATAGAGACCGGGATGAGCGGGATCGCGATAGGGACCGGGATCGTGATCGGGACAGAGACCGGGATCGCGACAAATTAAGAGAGAAAGATCGGGATTCTGAGCGAGATCGAGAGAAGGAGCGAGATTTTGATGAGGATGAAGAGATAGACCGACGGCGAAGAGAAAGGAAACAGCGTGAAAGAGATGCGGCTTATCAGGAGCGTCAGAAAAACTGGGAAGCAAGGGAGCGGAAGAAAGGAAGGGAATATGAACGAGAAATGGAAAAAGAAGGAGAGAAGAAAGACGAACTGGCTCGTGAAAGAAAACATTTGTTGGAATTCCTTGAAGACTACGACGATTACAAAGACGATCCAAAGTACTACAAAGGAAGTGCATTACAAAGACGAAGACGTGAGCGTGAAACGGAAGTGGAGTCAGATGAACGAGACAGGCAACGAGAAATGGAAGAAATAGAAGAAATAAGGAAAAGAATAGTGGATAGTCAACCCGAGGATATGGAACAAGAACAGGTTTCTTTCCAGGAGGAGAAAGACAGCGAAAAAGAAGAGGAAAAACCAGTGCTATTACAACCGACTTTTAAACCAGCAGTGACACCGCAACCTCAGTTCATTGCTCAAGTGGAACCCGCTCCAGCATCAAATTGGTCACCGAGCCCCACGTCAGCAGACTCATCTCCAGTCCCTGCTGCCCTGAAAAGACCGCGTGAGAATGGTCAAGAAGCAGACCCTGAAATTGAACCAGCGCCTAAAAAAGCGTTTGGCTTTGAAATGAAGTTGAGCACTAACTTGCCCTCCGCTGCCAACCAAGCAAGTCGTAAAAAACTTGAATCGGTGTTTGGTGGTGGGGATGACGATGAAGCAGGAGGCGCGGTACCCAAGCGGAAACTGGTGAAACTGGACGACGAGGATGTATCAAAGGATGAGACGGATGAAGCAGAAGATAAGAAACGGATTATTAAGTCGCTTATTGAACGTATACCTACTGCTAAAGATGAACTCTTTGCTTATAGCTTGGACTGGACAATTGTGGACCAGGGTCTTGTCGATCGTAGAATACGCCCATGGGTAAATAAGAAAATAATTGAGTATATTGGCGAGGAAGAGCTGACCCTTACAGACTTTATCTGCAGTAAGGTCATTGCTCGAAGCACGCCGAAACACATCCTGGAAGATGTCTCCATGGTATTGGACGAGGAAGCAGAAGTATTTGTGGTGAAAATGTGGCGTCTGCTCATTTATGAAACAGAGGCAAAGAAGCTGGGGAATATGAATCCTCCCATTTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
B2RY56	RNA-binding protein 25 OS=Mus musculus OX=10090 GN=Rbm25 PE=1 SV=2
P49756	RNA-binding protein 25 OS=Homo sapiens OX=9606 GN=RBM25 PE=1 SV=3
Q8VY15	RNA-binding motif protein 25 OS=Arabidopsis thaliana OX=3702 GN=RBM25 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003613 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01480 all species →	PWI	PWI domain	Family	Interproscan
PF00076 all species →	RRM_1	RNA recognition motif	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000504 all species →	Domain	RNA recognition motif domain	Interproscan
IPR002483 all species →	Domain	PWI domain	Interproscan
IPR012677 all species →	Homologous_superfamily	Nucleotide-binding alpha-beta plait domain superfamily	Interproscan
IPR036483 all species →	Homologous_superfamily	PWI domain superfamily	Interproscan
IPR035979 all species →	Homologous_superfamily	RNA-binding domain superfamily	Interproscan
IPR052768 all species →	Family	Pre-mRNA_splicing_regulatory_protein	Interproscan
IPR034268 all species →	Domain	RBM25, RNA recognition motif	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR18806 all species →	RBM25 PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan
GO:0000381 all species →	Biological Process	regulation of alternative mRNA splicing, via spliceosome	Interproscan
GO:0003729 all species →	Molecular Function	mRNA binding	Interproscan
GO:0005681 all species →	Cellular Component	spliceosomal complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K12822	RBM25, S164; RNA-binding protein 25	-	Spliceosome	ko03041	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074632115.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

71TPM > 0

2Conditions

155.9Max TPM

66.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	37	51.48	105.75
all_coral_tissue · baseline	38	34	83.69	155.88

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	105.75
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	104.56
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	98.27
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	95.39
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	95.16
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	89.73
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	85.12
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	84.83
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	84.09
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	82.92
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	82.07
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	79.58
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	78.33
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	77.29
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	73.07
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	71.80
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	70.61
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	70.32
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	67.19
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	66.29
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	61.11
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	54.43
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	52.63
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	51.96
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	47.35
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	44.26
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	42.28
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	42.11
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	41.83
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	39.13
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	38.99
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	36.13
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.45
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.66
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.20
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.73
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.46
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	155.88
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	147.65
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	129.24
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	128.12
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	127.90
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	127.60
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	127.50
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	126.34
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	119.28
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	118.13
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	117.47
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	113.30
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	112.36
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	112.19
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	111.68
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	110.89
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	102.80
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	100.07
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	87.63
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	87.41
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	83.29
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	77.14
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	75.31
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	71.62
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	63.71
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	62.27
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	60.20
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	60.14
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	51.92
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	49.67
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	43.37
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	43.29
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	41.61
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.22
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.