Gene detail

Detailed information of XP_074633004.1 in Acropora palmata

Genomic Location: NC_133890.1:20612515...20626344
NR annotation: XP_029187689.2, LOW QUALITY PROTEIN: double-strand break repair protein MRE11-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074633004.1

ATGGCGGTCCAGTCGGATGCAGATCCGGAGAATACAATATCAGTTCTTGTAGCCACAGATTGCCATCTTGGGTACTCGGAAAAGGATCAGGTTCGTGGGAACGATTCGCTGTCTACATTTGAGGAAATACTACAGATAGCCAAGGATAAAAAGGTTGACTTCATTTTGCTTGGCGGTGATTTGTTTCATGAGAATAAACCATCTCGCAAGACATTGCATGGTACCATGGCATTGTTCAGGAAGTACTGCATGGGTGATAAACCCTGCCAGTTAGAATTCCTTAGTGATCAGTCTGTAAACTTCTCCAATTCCAGGTTCCCTGTGGTTAATTATGAGGATCCCAACTACAACATATCAATCCCAGTATTCTCGATACATGGAAATCATGATGATCCAGCTGGGGATGGTAACCTGTGTGCCCTGGATTTGCTCAGTGTGTGTGGGTTTGTCAATTACTTTGGTAGAGCTGCATCCATTGATGACATCACAGTGTCACCAATCTTGATTCAGAAAGGTAGAGCCAAGCTGGCTTTGTATGGTCTGGGATCCATTAGAGATGAGAGACTACACAGAACATTTTTGAACCAGAAGATTAAAATGTTGAGACCCAAAGAAGATTCAAACTCCTGGTTCAATGTTTTTGTTCTACATCAAAATAGGTCAAAGCATGGCTTGACAAACTACATTCCAGAGAAATTTTTAGATGACTTTCTTGATCTAGTGATATGGGGACATGAACATGAATGTATTATTGATCCAAAGGAATCAGAAGACCCAAATGTGTCCTTTTATGTAAGTCAGCCTGGTTCCAGTGTGGCTACTTCACTATGTGAGGGAGAAGCCAAGACAAAGCATGTAGCAATCCTTGAAATAAGAGAGCAGGGGGGCTTCCGAATGACCAAGGTTAAATTGGAGACAGTACGTCCATTTTACATAGAAGATGTGGTGTTGAGCAATACTGATATTGATCCAACACAGGAAGAGAGGGTGATGGCTTATCTAGTAGAAAAAGTGGAACAATTGATTGAGAAGGCAGGGAGGGAACACTCAGGAAATCCTCGCCAGCCAGACAAACCCTTGATAAGGATACGAGTTGACTACAGTGATGGATTCACGTCATTTAACACTAGAAGATTTGGGCAACAGTTTGTTGACAGGGTGGCCAATCCAAAAGATATTTTGCTCTTCTACAGAAGAAAAACACACCCAACAAAAGGAGATAAGAAGAATCAAGGTGACACAAGGATTCCTCACCTTCATCCAGAGGCACTGGACACTATAAGAATGGAAGATCTGATTAAAGAATACCTTACATCCAAAGATAATGCATTGGAACTTTGCATTTTAACAGAAGGGAGAATGGCACAAGCCCTTCGAGAGTTTGTAGAGAAAGATGAGAAAGAGGCAATATCTGCATTAGTGAAGTGGCAACTAGATCAAGCTCAAAAGCACCTTAAGGCACGGCGTAATGTCCGTGAAGAGAACATTGAAACTGAAGTAGTCAAACACACAGAAACAGTGCGACAGAGAGAAGAAGAAGATGATACTATGGAAACAGAGGACATCAGAAAAGTGTTGCAAGAATCTCGTGCCAGCCAACTAAACAATGATGATCACAACATGAATGGAAGTGGCAGTAGTGATGATGACAGACCAAGCACTATCGAAGGTATAAAACCAAACACATCCACTGTAGGTAAAGGTGATGAGCGTGGCAGGGGACGGGGGAGAGGTAGAGGAGCCCATGGGAGAGGGCGAGCAGCAGCTGGCACATCACATACTATCATGGATTCAATTAATTCAGCATCTAAACGGAGGAGACCGCAAAAAAAGGTGCCACAGGAAATAATCTCTGATGATGATGATGATAATAGTGAATCCAATGTTTCTTTGGCATCATCTGCGCAGAGAACAAGAACTACACGACCCAGCACATCACAGGTGTCTATGAAAGGCAAAATGAAGAAGGACGTTATAACCTGTGTTGTGAATGAAGATGACAGTGACGATTCTGATGATCCATTCTCCATGCAACCAAGCAATAAAAGAAGCAGAAGATGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9W6K1	Double-strand break repair protein MRE11 OS=Xenopus laevis OX=8355 GN=mre11 PE=1 SV=1
Q60HE6	Double-strand break repair protein MRE11 OS=Macaca fascicularis OX=9541 GN=MRE11 PE=2 SV=1
P49959	Double-strand break repair protein MRE11 OS=Homo sapiens OX=9606 GN=MRE11 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003776 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00149 all species →	Metallophos	Calcineurin-like phosphoesterase	Domain	Interproscan
PF04152 all species →	Mre11_DNA_bind	Mre11 DNA-binding presumed domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR004843 all species →	Domain	Calcineurin-like phosphoesterase domain, ApaH type	Interproscan
IPR003701 all species →	Family	DNA double-strand break repair protein Mre11	Interproscan
IPR029052 all species →	Homologous_superfamily	Metallo-dependent phosphatase-like	Interproscan
IPR041796 all species →	Domain	Mre11 nuclease, N-terminal metallophosphatase domain	Interproscan
IPR007281 all species →	Domain	Mre11, DNA-binding	Interproscan
IPR038487 all species →	Homologous_superfamily	Mre11, capping domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10139 all species →	DOUBLE-STRAND BREAK REPAIR PROTEIN MRE11	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016787 all species →	Molecular Function	hydrolase activity	Interproscan
GO:0004520 all species →	Molecular Function	DNA endonuclease activity	Interproscan
GO:0006302 all species →	Biological Process	double-strand break repair	Interproscan
GO:0008296 all species →	Molecular Function	3'-5'-DNA exonuclease activity	Interproscan
GO:0030870 all species →	Cellular Component	Mre11 complex	Interproscan
GO:0004519 all species →	Molecular Function	endonuclease activity	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0030145 all species →	Molecular Function	manganese ion binding	Interproscan
GO:0000014 all species →	Molecular Function	single-stranded DNA endodeoxyribonuclease activity	Interproscan
GO:0000723 all species →	Biological Process	telomere maintenance	Interproscan
GO:0000724 all species →	Biological Process	double-strand break repair via homologous recombination	Interproscan
GO:0006303 all species →	Biological Process	double-strand break repair via nonhomologous end joining	Interproscan
GO:0007095 all species →	Biological Process	mitotic G2 DNA damage checkpoint signaling	Interproscan
GO:0031573 all species →	Biological Process	mitotic intra-S DNA damage checkpoint signaling	Interproscan
GO:0035861 all species →	Cellular Component	site of double-strand break	Interproscan
GO:0042138 all species →	Biological Process	meiotic DNA double-strand break formation	Interproscan
GO:0097552 all species →	Biological Process	mitochondrial double-strand break repair via homologous recombination	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K10865	MRE11; double-strand break repair protein MRE11	-	DNA repair and recombination proteins	ko03400	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074633004.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

54TPM > 0

2Conditions

22.6Max TPM

7.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	29	5.90	15.71
all_coral_tissue · baseline	38	25	8.43	22.59

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.71
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.24
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.65
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.64
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.61
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.55
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.35
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.22
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.19
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.60
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.56
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.41
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.29
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.96
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.82
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.15
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.84
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.18
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.90
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.64
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.46
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.34
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.29
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.22
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.80
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.24
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.91
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.27
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.18
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.59
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.61
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.47
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.10
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.42
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.27
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.77
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.06
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.94
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.39
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.49
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.16
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.48
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.35
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.30
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.00
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.82
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.80
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.66
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.54
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.40
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.32
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.06
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.02
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.18
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.