Gene detail

Detailed information of XP_074633155.1 in Acropora palmata

Genomic Location: NC_133890.1:17172432...17191684
NR annotation: XP_029186161.2, peroxisome biogenesis factor 1-like isoform X1 [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074633155.1

ATGAACAGGGTTAGATCGGCTTATGTGAAAACCAACTCATCGAAAGCCTGTTTTATCAGCTTATCAAGTGATCTCGCTGAGGCAATAGGACAACGAATTCAGGGTCAGCCTTTCGCTATTCAACTGCAATGGCAGAATGGTAAGGCCTTTACTAGTTGGTCTGGTGTGGTAACTCGCAGCCAAAAACATGACTCTTGGGCAGGAACGCCATCCACCATAGAACTTGGTAAAAAGTTTGCTGATGCTCTTGGGTTGGAAGACAATCAACAGGTAATTGTTGAACCTGTTGTTAGTTTACTATCCTGTAACCGGATTAGTGTGGACCCTGTCAGCGTTAATGATTGGGAAATCCTGGAACTCCATGCTGGATACATAGAAAACCAGTTACTTCATCAAGTTAGAGTTGTGTTTCTTGGTCAGCTGCTTCCCATTTGGATCCAAAACCAGATTTGTGTAGTTGTCAAAATTGTTCAATGCAAATTTTGGTCTCTCTCAAGCAGTGTTAAAAAGCAGCAAGTTTCAATTGATCTGGAGCCAAAGGTTGATTGCTTGAGGCTTGATGAGTTCACTGAGGTGATTATTTCCCCAAGGAAAAGAAATTTTTCTCCATCTAAAGACCTTCAAGAGGCCTCTTTTACACAAGAGAATCATCGTGGAAGAGAAACCATTTTACCGAGTGAACCTTCTCATCAAGTTAATGGAAATAATGATGCTCAGACAGCAGATTCAAATTCACGTCACACAAGCGCATCAGAGCATACTGGCCATGTTGACAGTTCATTAATGTCTAGATTCTCTGTTTTTGTTCAGTCATTGTTGTATGGCCACAATGAACAAACTTCTGTTGAGTCTTGTAAATCGTTAAGCACATCACATCAAGAAAACATGACTGGCTATTCTTCCAAAGTGTCTCCAAAACTTGACAATGATGTAGTTAAAGAAAGTGAATTTCACCTGTGCTTGAGAGTGCAGCCAGAGTTCACAATACAAGATATTGAATCAAATAGAACAAATACCTCAGAATCCTCCTCCATGATCTGCCCAGCCTCGCAATGTCCAATGAGCCTTTATTCCTTACAACCTTCAGCAGTGTTTGTGGACTATTCATCGTTGCCATCTCCAGTTTTCAAGTTATTGACTGGTCATTTAGATACATTTCCTCCTTTAAATGGGACAGTGGTGAAAACTATGCAAATGACTAAATTGATGTCACCGAAAGAGAGAGCCTCCTTAATGCGCACCAGTAACAGTTCACCAAGTGGTGACCTTGATATGTCAAACCATTCCAGTCCAGTCCAAGAGGAAACCACTGAAGGAGCTAATGACTCATTGATGCAGAGTATTATTGTCACCATGGTGATGACAAGCAGAGAACATAACATCCTCTCAGAGCAAGAGCCTCTTATACTGCAGCAGACAAAGCATGTACTACCAGGTCATGTTCGGGTTTCAAGAGATCTATGCCATATACTTGATTTAAAGGAGTTGTCAATGGTCAGACTGCAGAGTGTATCATATGGTTCAGCAGTTATCAAAGGGATTGTTTTGCATCCACACGAAGACATGAGACAAAAGAACATTTCAGATGATGCTGTGGTAACTGCTTTCAATCAGTGGATATCATCTGTTTGTAGTGAAGACGTTCCCCTTGTACTCTTTAGTGGAATGCTTATTTCCATTGGAACATCACAAGGAAGCTGCCCACTTTGGTTAAAAGTCATTGTGTTGAGCTCTCAGGATGCTAGTCCATCAGATAAACTTCCATATTATCAGATGACACCTGAGACACTTAAGAATGTGACAGTTGTTATTGGCACACCTCATAATCTTCCAAGATGTCCTGATCAAGTTTCAACAACTCCAGCAAAGCATAAGATTACAGATCTTGGTGGAGTAACAGACTGCTTTAAGAAATGCCTGGATCATGTCTTGTCATCATTAAAACAAAGACCACTTGCCAATCAGCTTGGTGGGAACATCATCACAGGCCTGCGAAGTGGTGCACTGTTAATCTGTGGAAGTGGTTCTGGGGCAGGTATTGGCTGTGGGAAGACAGCTCTTGCACATGCAGTTTGCTATCAACTTCAGCAATGGCCTGTGTATGCTCACATCACAGTTGTGGATTGTGTACCATTTAGAGGAAAAAGAGTTGAGACCATTAAAAAACAGTGGCATCAGGTCTTTGTTGATGCTGCGTGGCATCAACCAGCGGTTATCCTGTTTGATGATTTGGATCAAATTGTCTCTGCTCCCAGCGGCTTGCAAGAAATGGGTGGAGAAGCTCTGTATAAACAGCGACTTGCTCAAGGATTCAAAGAACTTGTTGCAACAGAGATTAAAAATAACAGTAGAATAGCTGTCATAGCAACCAGCAAGTCTCATGATTCCTTGCATCCTTCACTATTGACATCAAGAGGTTGTCATATCTTTCGCTACTCTGTGGAACTCCACCCACCAGATGCCAGTCAGAGGAAAGAAATCATGTGTGCAATGATGAAAACAAGATTTTCAAAAACAGATTCATGTGATGTAGAATTTAGCTTTTTGGCCAAGAAGACAGAAGGATTTTCTCCCAAAGACCTTAGATCGTTGCTTGATCGTGCTTGTCATAAGGCAGCAGTTAGAAAGATGACAACTTCTAAAGAGAGAGGAACTTCCCTTTCCCTAATTACAGAAGATTTTGAGAATGCCCTGGAAGGTTTCACCCCTGCAGCATTAAGGGGGGTAACATTGCACACTGCTGGAGAGTTAGGTTGGACTGATGTTGGCGGTCTCACTGCTGTTAAGGATGCTCTCATGGAAACACTCCTGTGGCCAACAAAGTACTCTTGGTTGTTTAGCAAGTGTCCTCTGCGTTTGAGATCAGGACTTCTTCTGTATGGGCCTCCAGGTACTGGGAAGACACTGCTGGCTGGTGTGGTTGCCAAGGAATGTGGGCTCAACTTTATCAGCATTAAGGGACCTGAGCTATTGAGCAAGTACATTGGAGCTAGTGAACAAGCAGTGAGAGACATGTTCACAAGAGCCCAGAGTGCCAAACCATGCATCCTCTTCTTTGACGAGTTTGATTCACTAGCACCGCGACGGGGGCACGACAGCACAGGGGTAACAGATAGAGTTGTCAATCAACTGCTTACACAATTAGATGGTGTGGAAGGGCTTGATGGTGTTTATGTTCTGGCTGCCACAAGTCGTCCAGATTTAATAGATCCTGCACTTCTCAGACCAGGAAGACTGGACAAGTGTTTGTATTGTGGCATTCCAACTAAGTCAGAGAGGTTGCAGATACTCCAGGCACTGGCAAAGTCTCTTACTTTAGCTGATGATGTGGACTTAGATGTAATAGCTGACATGTGTGATAATTTTACCGGAGCAGATTTCAAAGCACTGCTGTATAATGCTCAATTAGCAGCAATACACAGGAGTACTAACAGCAGTCAACTCTACAAAGGACTGTTTAGTGACGAAGACAGTGAAAGATCCAACCCAGAGCAGTTTAGAAAAGATGCGTTCTTCATCCCAAGCTTGACCAAAGGTGTTGTGCATCTTCCAGATGAGGATCAGAATAAGTTGAGTTCTGAGGTTCTGGCTTTACTAGACAACCTACAGCCAAAAGGAGAAGATGAAACGGTTAGGTCAGATGTTTCTAAACAACAAGCAGTTTCTGGAATAACAATCACACAGTTAGATTTGCGGGAAGGAACAACATCAATGGGACCATCAGTGTCAGATAGTGAGAGGCACAGATACCAGGCAATATATGACAAATTTGTAAAATCACGTGGTGGAGAATTTTCTCAAAACAGGCCAGGCCAAGGAAGGGCAACATTAGCATGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O43933	Peroxisomal ATPase PEX1 OS=Homo sapiens OX=9606 GN=PEX1 PE=1 SV=1
G3GXG9	Peroxisomal ATPase PEX1 OS=Cricetulus griseus OX=10029 GN=PEX1 PE=3 SV=2
Q5BL07	Peroxisomal ATPase PEX1 OS=Mus musculus OX=10090 GN=Pex1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003407 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF09262 all species →	PEX-1N	Peroxisome biogenesis factor 1, N-terminal	Domain	Interproscan
PF00004 all species →	AAA	ATPase family associated with various cellular activities (AAA)	Domain	Interproscan
PF17862 all species →	AAA_lid_3	AAA+ lid domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR029067 all species →	Homologous_superfamily	CDC48 domain 2-like superfamily	Interproscan
IPR050168 all species →	Family	AAA ATPase domain-containing protein	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR015342 all species →	Domain	Peroxisomal ATPase PEX1, N-terminal C-lobe	Interproscan
IPR009010 all species →	Homologous_superfamily	Aspartate decarboxylase-like domain superfamily	Interproscan
IPR003959 all species →	Domain	ATPase, AAA-type, core	Interproscan
IPR003593 all species →	Domain	AAA+ ATPase domain	Interproscan
IPR003960 all species →	Conserved_site	ATPase, AAA-type, conserved site	Interproscan
IPR041569 all species →	Domain	AAA ATPase, AAA+ lid domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23077 all species →	AAA-FAMILY ATPASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005778 all species →	Cellular Component	peroxisomal membrane	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0016558 all species →	Biological Process	protein import into peroxisome matrix	Interproscan
GO:0016887 all species →	Molecular Function	ATP hydrolysis activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0005777 all species →	Cellular Component	peroxisome	Interproscan
GO:0007031 all species →	Biological Process	peroxisome organization	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K13338	PEX1; peroxin-1	-	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074633155.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

69TPM > 0

2Conditions

47.9Max TPM

17.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	38	15.62	47.85
all_coral_tissue · baseline	38	31	20.28	37.52

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	47.85
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.99
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.70
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.37
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.09
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.90
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.72
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.12
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.40
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.01
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.42
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.98
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.55
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.77
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.58
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.31
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.09
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.28
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.93
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.21
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.41
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.11
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.05
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.21
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.58
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.80
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.23
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.84
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.49
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.30
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.05
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.92
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.55
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.28
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.81
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.60
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.16
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.10
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	37.52
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.97
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.55
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.42
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.15
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.16
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.82
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.53
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.29
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.99
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.66
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.86
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.77
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.79
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.22
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.93
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.36
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.92
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.12
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.39
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.31
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.25
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.05
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.67
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.83
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.77
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.04
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.22
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.17
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.15
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.75
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.