Gene detail

Detailed information of XP_074633477.1 in Acropora palmata

Genomic Location: NC_133890.1:20043250...20050872
NR annotation: XP_029188409.1, zinc finger protein with KRAB and SCAN domains 7-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074633477.1

ATGTCTTTTGAAGAGGGAGGAGATCTAGCATCCTTTGCTGCTATTGCTGAATCGACAATCGCCAGTAAAGAAGATGAACCCACTGAATTGGCTCCAAAGGGAGAGGAAGATGGACAGTCTTCAAAGGAAGAGGAAGGTGCAACCAATGAAAGCGGCATAGATGATACAAAAAATGAGAAAAATGCAGAGGAAGCTTCATGTAACACTGAGGCTATTTCAGAAACAGATGGAACTTCTGTGCAACTAACCAGTGAACAGGAACGCACATATGCTAATCTTCAGCCAATTTTCTTAGCCATGGAAATGGGACAAGATGCAGTTCAGGTTAACCAAACAGAGGAGCAACAGCATCAAGAGGGTACAACTGAAGAAATGGAGCAGCGACAAACAGCCTTTATTGCCACAACCAGCGAGTTTACAAACACAACCCAAGCTGCTAGCATGCTACTCAGTAATGTAACCACCACAGGTGCTGAGCCACCAGCCTCTTTAGCTTCAATTCTTCAAGATGTTGTGTCTGGCATGCAGAGCAGTTCAGGATCTGTTCCAGCAGCAATTATTACAGATCCTAGCTCAAGCAGTGGCTCCTTTCTGATTGTTAATCAAAATGGAGTTCCTATAGTTCGTCCTGTGCTTGTGTCAAATCTGCCTGGTGGAGGAGTTGGTGCAAGTGGGGCAGTCAGTGTTTCGGCCGAAACTCTTCAGGTGTTGACAGCAGGTCTTCAGGCTGTTGATGATGGAACAGCTGGCAGTGCTCAAGAAACAGTGGCAGTTGACGTTGGTGCTTCCACCGAGGGTACAAGTGCTGGCGGAGAGTTGTCTGTGGAGGCCACTGTTGATATTGGTGGTGATACAGTTACCTTGGTTGGTGGTACTCAAGCTGTGACACAGGCTGTTGGTGATGCTACAACTGGATTAGAAGGAGCACATGAGGAAACAGCTGCTATGCAAAAACCCGTTGCTACCAGGACTCCAACAGGAAAAAGGAAGCTAAGTGATGGTCCAAGGGTTTGTGAACAGTGTAACAAAAGTTTCAAGTATCCATCTGATTTGAAGAAGCACTTGCAGATTCACACAGACATTAAAAAGTTCAAGTGCGATGACTGTGGTCGTTTCTTCCGCCGCTTGCATCAGTTAAATGTACATCAGAGGATTCATTCAGGCGAGAAGCCCTACGTTTGTAACAGGTGTGGCATGGCTTTCCGTCATGACTCCACTGTCACTATGCACATCAGAACTCGTCACGATCACCTCCGACCCTTCAAGTGTGACGAATGCGGTAGTCTGTTCGGACGGCTCTCGCACTTGAAGAAACACATCCGTAAAGTGTGTGGGGACAATAAAAACAAGGAGAAGCCCATAGCTCAGTGCCGCTTCTGCGATGTTACCTTCCCCACCAAGGGAGACCTAAGGAAACATTTGTTGAACTGCGAGAAGAAAGAAGCCAAAGTGAAAGCCAAAGAAGTTACCCTGCACATCTGTGAAACTTGCAACAAGGAGTTCGCTAGCCCGTACAACTTGCGACGTCACCAGCTGACTCACACAGACGAAAAACCTTATCAGTGTGACGTCTGCAACCGACAATTCAAAGAGAAGTCCTCACTCACAAAGCACATCAAACGCAAACACACCGGGGTGGACCAAGGAAGTCAAACAGATGAGACCGGGGAACAGGAAGATGGATACGTGAACGTTGACGTCATAGCCGAATCGGCGGCAGCAAGTGGCGTTACTATGGAAACGGAGGAAACTGTTGAAGCAGGTATTGCTGGGGAGAGTGTGGAAGAAGCATCCACTGTGGATGCCAGTTCTCTGATGAGTGAAGGCCAAGGTAATGCGGAGCAGGTGACCGAGGTGGTACAAGCTAGCGGTGAAGTAGAGATGGCGACAGTGGAGCTCAGTTTAGCAAATGCTGCGGCTGCGGCTGCTGCCTCAAGTCATTCCCATGACGCTTCCGCATTGCAGGCTGCAGTGGAAGCGTTGGTGTCAGCTAGTCAGCATCAGATGCCTGGAGCTCAAGAAGCCATGGAGGAAGAGGAAGACTCTTCCTCTGGCAAGGAGATTTTTGATGGTGTGACATCCCAGGATGCAGAGGGAGCAGCTGCTCTAATGGCAGTCTACGTTCCCGAAGTGAAGCAAACGGAAGTGAATCTGCAGGTGGAATACGTGCAGACCACTGAAGAAGATCAAGAGATGGTGGACGAAGAGGAAAATTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P17012	Zinc finger X-chromosomal protein OS=Mus musculus OX=10090 GN=Zfx PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005385 (this species only) · gene tree & orthology
Transcription factor family	zf-C2H2 · all TF in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00096 all species →	zf-C2H2	Zinc finger, C2H2 type	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR013087 all species →	Domain	Zinc finger C2H2-type	Interproscan
IPR036236 all species →	Homologous_superfamily	Zinc finger C2H2 superfamily	Interproscan
IPR050589 all species →	Family	Ikaros C2H2-type zinc-finger	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24404 all species →	ZINC FINGER PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000978 all species →	Molecular Function	RNA polymerase II cis-regulatory region sequence-specific DNA binding	Interproscan
GO:0003700 all species →	Molecular Function	DNA-binding transcription factor activity	Interproscan
GO:0006357 all species →	Biological Process	regulation of transcription by RNA polymerase II	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for XP_074633477.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074633477.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

78TPM > 0

2Conditions

104.0Max TPM

49.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	42	44.32	103.96
all_coral_tissue · baseline	38	36	56.64	87.51

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	103.96
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	89.72
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	86.99
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	80.75
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	77.72
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	76.31
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	74.81
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	74.26
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	72.93
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	72.53
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	69.46
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	69.21
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	66.04
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	62.83
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	60.09
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	59.94
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	57.94
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	57.30
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	55.80
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	52.47
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	51.80
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	51.66
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	51.12
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	40.00
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	39.69
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.98
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.78
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.15
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.04
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.84
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.07
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.83
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.56
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.33
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.97
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.42
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.17
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.30
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.13
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.44
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.88
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.43
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	87.51
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	85.32
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	83.44
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	83.37
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	83.02
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	82.12
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	81.38
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	77.37
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	75.85
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	74.80
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	74.73
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	73.27
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	72.23
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	70.33
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	69.91
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	69.26
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	68.02
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	67.49
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	67.18
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	64.68
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	64.45
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	63.99
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	61.96
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	56.12
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	52.49
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	48.44
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	43.17
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	39.37
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.77
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.26
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.49
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.20
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.54
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.26
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.99
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.40
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.