Gene detail

Detailed information of XP_074633486.1 in Acropora palmata

Genomic Location: NC_133890.1:20160961...20174033
NR annotation: XP_029188398.2, integrator complex subunit 6-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074633486.1

ATGTGTAAAAGTCATCCCAAGAATATGGTGATATTTGTTTTTGTTGTCGATACCTCTGCGTCTATGAACCAAAGAACGTCTGTGGGCACTACTTTGCTTGATGTCGCCAAAAATGCCGTCGAAACTTTTACGAAGCTACGTCAGCGAGATCAAGCGAGTCGAACAGACCGATACATGCTGGTGACGTTAGAGGAACCGCCAGGAGCTATAAAGGCGGGATGGCGTGAAAATCAAGCAACGTTCATGAATGAAGTAAAGAATCTTCAAGCCACTGGTCTATCAACTTTGGGTACTTCTTTAAAAGAAGCATTTGACCTGCTGAATTTGTATCGTCTCCATTCTGGAATTGACAACTATGGCATGGGAAGAAATCCTTTTTACGTTGAGCCCGCATTGGTTGTATGTATCACTGACGGTAGCAAGCTTTCTTCCCAGAATGGTGTTCATGAAGAGCTCCATTTACCAATGCACACAACCTTGCCTGGCCATGAGCTCACTACAGAGCCATTCCGTTGGGATCAGCGATTGTTCTCTATTATATTGCGTATGCCAGGAACCAGGAGTTCCTTGCCAAATAAAATGGGGATGCACAATGGTGATCCAGCCATAGCAGCCATGTGTGAGGTCACAGGAGGGAGATGTTACAAAGTCTCATCTTCCAAGTCCTTGGGGCAAGCTTTGGAATCACTTGCACAGAAAGTGCAGTGTGGGGTGGTGTTGAATTTTGAAAAGATTGGTGGGGCTACCAACCCTCCACCCCCAGCTCCTGAAGTTGTGAAGCTTAGTGGAAACGAGTTGCGTGACAATGACTCACCTACCCCACCTCTTTCCGTACATAACCATACAATGAATAATGTGGACTATAACAAAGAAGGTGTGAAAGACAAGAATTCGCTTCATGATGAAAACCTTCTGAGGGCAGACGGTGCAAGAATAAATCAAAGTGGAGAAAATTCAACTTCAAACTCTCTCTATCCTGAGGATAATCTTGGTGTTGTGGGGATTTCACGATCAGCCACAAGCTCACCAGGACCACAAACCGTACAAACAACAGCATGGATGAGTTGCCGGAGAATGATATATATCAAGAGTAATTCACCCTCAGGACACTGGCCTGTTCCAGAATCATTCTGGCCAGACCCATCAATGCAGTCTCTGCCACCACGAGATGCACACCCCAGTGTGATGTTTTCTTGCAGTAACTCAGAACCATTAATTCTTGACAATTTACCATTTGACAAGTATGAATTGGAACCATCACCTCTTACACAGTACATTCTCGAGAGGAAATCACCATCAACTTGTTGGCAGACGTTTATTGTAAATAGCTCAAAGAAGCTTGGTGACATTGGATTTCCCTTTGGTTACCTGAAAGCAAGTTCCAATCTTCAAACTGTGAATCTGTTTGTCATGCCATACAACTTTCCTGTTCTTTTTCCCATCGTAGATGAACTTGTCAAAGTTCACAAGATGAAACCAACATTAGCATGGAAAGAGAAATTTGATAACTACTTGTCGACAATGCCTAACTACTATGCTGGGCCTCTTCGTAATGCCTTCCGCCGCATGGGTATTCCTTCAGCCTTTGTTCCAGACCATTTAGATTCCTTCCTGAGCTACACAGTTGTCAATTATTTAAAGAAAGTGAAGCAACAGAGTAAAATGGAGACTGAGAGGCTCATTTCTCTTGTTGGAAAAAATGCCACCAGAGATGCTGTGCCAAGACCACTTTTGAGTGTGAGAACACCACAGTTACCAAAAGCCAAGAAACAAGATTTTCGTGCACTACTGCATAGTAATTTTTCTGTTAACAGTGAAGATAGTCGCATTACCAGTGAGACTGATTTCAACATTCCCAACACCTCATTTCATAATGTTAAACAAAACGTGCGAGCACAAAGTTACAAGAATCCATTTGACATTTCAAGAGATGAGCTTCTGGACCAAGTGTCTAGAATGAGAATCAACTTTTTTCACACTGCAGCAACATCCACAAGACTTCAAGACGAAGATGCTCGTCACAGTGTAGCCATTGCAGATATGGGTAATTATCAAGAAGTTCTCAGGCAATTGAGTCCTTTGCGTGAGGTTGATCCCGGACAGAACAGGGTGCACATGTTTGGAAATCCTTTTAAACTTGCTAAAGACCAGCGTGTATTGGTTGATGAGGCCGATGTTAATGAAGCAATGGCAGGTGTGCCATCTCGCAAAAGACCTGGTTCTCCAAGAGATAAGAAAAGGCAACAAGAGACACCACCAGTGCGGTGGCCAAACAAAGTTAATCAGAATGGTGGAAACTCAGTTCCTGTACCTCAGAACAACAAATTACCCCCTGACAAAAATGCGATTTTGCAAGATGGAAAAACAAATAATGTCTTTTCGGGCCATGGAATAAAGCGGAAACACGGTGACGGAAGTGAAGGTGTAAACAAGGTGCTCAAATCGTCAAAGAGTTTAATTAAACCACAACTTGCCAAACTTCAGCAGAGACTGCACAATAAAGGGAAGATAAACTGGAAACAACAACCAGTTGCAAAGACTGATAGTATTAATTCCTCAAAGAATGACTTTGTTTCATCTATTCTTAAAGAAGCAGTAACTTCTCAGAGTAGAACGTTATCAGGGCAAGGAGTACCTGTTGAAAATTCTCATGACAGTTCCACAAGTAAAAATGTATTGACAAACTCTGAATCCCAAGAGTCGTTTGCAGATTGTCTTTCAAAAGAACAAGAAGGGGGATTGTCACCAAGAGCACTGAAAAAACAGCTGATACAAGAAGCTTGTGAAGAAAACAGGTTAATAAGAAATCAGGTGTTCAGGGACATAAGGCAGCCAGAAAAAAGTGATGACGTCATCCTTGATCGTGTTGCAAATCTGAAAGGATCTTTTGAAATTCAAAGTTCCACACTACAGGAAATCATAGAAGAGGCAGAACTCTTCAAAAAGAAAGCATTGATTGAGAGACTGTCATCACATCTTGCAATCCTTCAGCAAAGACTTTCTCCAGAGTCATTTGATGCCAAGCTTGGCATTAAAAAAAGATAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6PCM2	Integrator complex subunit 6 OS=Mus musculus OX=10090 GN=Ints6 PE=1 SV=1
Q9UL03	Integrator complex subunit 6 OS=Homo sapiens OX=9606 GN=INTS6 PE=1 SV=1
Q2TAF4	Integrator complex subunit 6-A OS=Xenopus laevis OX=8355 GN=ints6-a PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005536 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF15300 all species →	INT_SG_DDX_CT_C	INTS6/SAGE1/DDX26B/CT45 C-terminus	Family	Interproscan
PF13519 all species →	VWA_2	von Willebrand factor type A domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036465 all species →	Homologous_superfamily	von Willebrand factor A-like domain superfamily	Interproscan
IPR029307 all species →	Domain	INTS6/SAGE1/DDX26B/CT45, C-terminal	Interproscan
IPR051113 all species →	Family	Integrator complex subunit 6	Interproscan
IPR002035 all species →	Domain	von Willebrand factor, type A	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12957 all species →	DEAD/H BOX POLYPEPTIDE 26/DICE1-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0032039 all species →	Cellular Component	integrator complex	Interproscan
GO:0034472 all species →	Biological Process	snRNA 3'-end processing	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K13143	INTS6, DDX26; integrator complex subunit 6	-	Spliceosome	ko03041	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074633486.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

62TPM > 0

2Conditions

61.1Max TPM

13.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	32	11.65	61.12
all_coral_tissue · baseline	38	30	15.53	30.07

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	61.12
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.34
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.32
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.02
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.67
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.76
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.55
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.32
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.61
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.55
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.14
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.25
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.98
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.59
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.46
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.98
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.38
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.93
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.38
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.87
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.94
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.22
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.64
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.52
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.99
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.91
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.52
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.99
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.92
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.04
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.58
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.54
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.07
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.12
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.78
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.59
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.34
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.22
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.35
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.29
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.36
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.27
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.16
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.07
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.77
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.72
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.71
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.49
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.49
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.46
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.72
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.63
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.57
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.15
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.91
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.63
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.11
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.39
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.62
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.90
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.69
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.45
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.