Gene detail

Detailed information of XP_074633558.1 in Acropora palmata

Genomic Location: NC_133890.1:2790575...2812200
NR annotation: XP_029201834.2, histone demethylase UTY-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074633558.1

ATGGTTTCCCAAGTTGATGTTCTGAGCGATCGAGAGAAGGATATTTTAACAAACTATGACAGCCGTTTGTACGGATTTCTACGAATACAAGATCCCATTGGAGATTCTTCTTTGCCAGACTTGACTCATAAATCTTTATTGCTTAAGGGTGTTGCTTTTTTCGAGAACGAGTTAAAGAAAGAAGGCAAAGCAGCTAATCCGTCCACCTTTTGCAAATTGGGGCATTTTCACCTGTTGCTCGAGGACTTTGCTAAGGCCCTTTCAGCTTATCAACGGTTTTTTAACGTCCAGCAAGTTAACTATTGGAAAGATGCTGCATTCCTTTATGGTTTAGGGATAGTGTACTTTAATTTCTCAGCATATCCGTGGGCAATAAAGATCTTTCAGCAACTACTCTATATTGATCCCAGTTTTAATTGCTCCAATGAAGTTCATCTTCGATTGGCAATCATTTTCAAAGCACAAGGAAGTTGTGAAGCAAGTGTTAAGCATTTTCAGATGGCTTTGATGGATTCTAGTCCCTGTTCATTGTCAAAGGTTGAAATTCGATTTCATCTTGGCCATCTTTACGAGATGCAAAACAAGTGTGAAGTGGCTCAAGAAATGTATGAAAATATTATAGAGATGCCAAATGTTCCTAACAACATCAGGGCTGATGCTTATAAACAGCTGGGGTGGATGTATTACAATAAAGAGCACCTTGGAGACAGGCCAACCAGGATGGAGAAAGCTGTTCAGTTGTTACTCAAGGCAATTGAGACTGACCCAAACAGTGGAGCGGCCTGGTACCTGATTGGAAGGTGCTATGCTATGCAGGGAAAGGTGCATGATGCATTTACATCTTACCGACAAGCAATTGACAAGTCAGAGGCAAATGCAGACACATGGTGTTCTATAGGTGTTCTTTACCAGCAACAAAATCAACCAATGGATGCACTCCAGGCTTATGTTTGTGCTATCCAACTTGACCCAACCCATGTTGCAGCTTGGACAGATTTGGGTATTCTCTATGAAGCCTGCGAACAGCTCAGTGATGCTATATCTTGTTACAGTGCTGCAAGACGATATGGAGCCACTGACAGCACAATTGAGGCTCGAGTGAAGGCTCTACAAGCTCAGCTAGCCATGATGCCGCAATCAGGAGAGGGACAGAAAAAGAACATTCCATCAGTGGATGAAGCTTGGAAGTTACCAATTCCTGCTGAGCTCACCACAAGAACAATACGAAATGCACAGGTGAAATTATTAACCAGTGGTCAGATTCATGGGTTGCAACAACAACAACTGCAGCTTTATTTACAACAACAAGCACAGTTGCAACAGCAACAGCAGCAGCAGCAAGGTGCATTGGTGAACAGTGCACAGGTTGCCAGCACTCAAGGTCTTTTTGACAACTCCAAAAATTTGGCCAACCATACAGCATTTCAGGGGGAAAAGCAAGACAATCTTGAACACATTACTGCTGTTCAAGGTACCCAACAATCAATTCCTGGAAATGACTTGCAAAATAACTGGCCTGAAACAGTGCATGCACAAGGCAATCAAAATGGGATGCCTGTGGTACCCTGCAATAGTGAGGTTTCAGGGAGTAATTTACCTTCTTGTACAACAACACAAGGTGTCAGTCTTCCAGTTGCCCATTCAGCCCTGCAAACAAATTCCGGTAATTTCTCTCAGTCAAACACTGTTCTTACTAATGCGTATGAGGATTCGAATGTTTCTGCAATGGAGACCTCGTCCGTCAGTGACCATTTGCTGCAGGCCACAGGGCATCAGAATTCAATCACAACTTCAGAGCCAGCAACACAGCCATTGCTTTCTTCCAATTTTGTGTCGACAGCAGTTGATGCGTTGCTTAGTCAAAGTGTTGTAAGTTGTCAGGGAACAACTTTTCTATCCAGTGGAACTATTGTCACAGAATCGACAACTTCATCTGGAATAGAGCCATCTATTTTAGGTGAAATCAACTCAAGTGCAGATGGAAAGCCAAGCCCATTGACAGGCAATGGTGACCCTACGCTTAGCAACGGGTCCATCTCAAGCTTAGCAGGATTTACAAATGCAACTATCATGTCCATTTCTCCATTTTCATCACCAAGTTATGTCATGTCGCCTACGCAGAAATCACCTTTTCACTCAACAGCATCTCTTTCTCCAAGCATCACTCAGCCCCTCTCCATCATTAACCCTACCTGCTTATCACCAAGTTCAGGTCTACAGGGAACACAGTCTGCATTCTCTCCTTCTCTCATTCCAACTGAGCTTTTGTCGCCCTCAAAACAGCTTACTGTGGTCTCCCCTACCTCATCCAAGTCGCGGTTCAATCTAAATTCAGGTGGTGATAATTTGGCGGTGCCAAAATTGAATCTACTGCTTGATGCATCTGCTATTCCTCATCCACCGCCTACACCTGAGCCCCCTCTTCCAACAGACAGGCTGTCACCACAGACTCCAAGTATTTATGTTGAGAATAAAAAGGATGCATTTTCAGCAGCACTTCAGAACTTGGTGTTAAACAACAGTGAACCCATACTTATGATACGAGGATTGGCTGCAGCGCTGAGATTAGACTTGAGTTTATTTTCAACGAAAACACTGGTTGAATCAAATCCTGATCATCAGGTGGAAGTCAGAACACAGAGACTTCAAGCATCAGATGAAAACTGGGATTCTGTGGGCGAGAACAAAGTATGGCTCTGTGAAAGCAGCAGATCGTTCACAACCGTTGCAAAGTATGCCCAATATCAAGCTAATTCATTCCAAGAGTCTCTAAAGGAAGAGCATGACAGGCAAGCGGGTGTGAAGGAACCGTTGCAATCTGATAGTGACTCTTCATCAAGTTCAAAGAATAGTAAAAAGGGCAAGGGCAAAAAATTCAAGTGGATCAAATTTGGTACCAATGTTGACCTTTCAGATGAGAGAAAATGGAAGCCACAACTTCAAGAGCTCACTAAACTTCCTCCATTTGCAAAGGTTGTAACCCCTGGTAACATGTTGAGTCATGTTGGTCACACCATTCTTGGAATGAATTCTGTGCAGCTGTACATGAAGATACCCGGGTGCCGGACACCAGGTCACCAAGAAAACAATAACTTTTATGCAATAAATATTAACATTGGTCCAGGGGACTCTGAATGGTTTGCCACACCGACCGAATACTGGGGAGTGCTTCATAGCCTCTGTGAGAAGAATAATGTGAATTTCCTAACAGGTTCTTGGTGGCCGATACTTGAAGAGTTGTACGAGGAACGTGTTCCAGTTTATCGATTTATACAGAGACCAGGTGACATGGTGTGGCTCAGTCCGGGGGTGGTGCATTGGGTCCAGTCACAGGGCTGGTGTAATAACATTGCGTGGAATGTGGGCCCGCTTACAGAGGAGATGTATAATGTTGCTATTGAGAGATACGAGTGGAACAAGCTTCAAGGTGAGAAGTCTATAGTGGCAATGATTCATCTTTCCTGGAACTTGGCCCGAAATGTGAAAATCGCGGAAAGAAAGCTGTTTGAGCACATCAGAGTGGTACTGGTGCGGTCGCTAAAGTACTGTCAAATAACTATGGAGAAACTAAAGCATGTAGGGATTGAGGTCATGTGGCATGGCAAGAGACAGAATGAAGGCTCCCATTATTGCGCCCAATGTGAGGTGGAAGTGTTCAATATTCTGTTTGTGACGGACAACAAGAAGCACTTAGTTTACTGTCAAGACTGTGCACGAAAGACCAGCGCCAATCTTGAGGGATTTATTGTTCTTAATCAGTACACCATCGAAGAACTGACAGACGTTTTCAACAACTTTAAATTACACACGGTGTCTTCGCGAATCGGAGATCCAATGATGTCCCAGAATTCCTCGCGATCCGTTGGCATGGTTGTCCAGGGAGTTTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O15550	Lysine-specific demethylase 6A OS=Homo sapiens OX=9606 GN=KDM6A PE=1 SV=2
O70546	Lysine-specific demethylase 6A OS=Mus musculus OX=10090 GN=Kdm6a PE=1 SV=2
P79457	Histone demethylase UTY OS=Mus musculus OX=10090 GN=Uty PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003599 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02373 all species →	JmjC	JmjC domain, hydroxylase	Domain	Interproscan
PF21326 all species →	KDM6_GATAL	KDM6, GATA-like	Domain	Interproscan
PF21322 all species →	KDM6_C-hel	Lysine-specific demethylase 6/UTY, C-terminal helical domain	Domain	Interproscan
PF00515 all species →	TPR_1	Tetratricopeptide repeat	Repeat	Interproscan
PF13431 all species →	TPR_17	Tetratricopeptide repeat	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR011990 all species →	Homologous_superfamily	Tetratricopeptide-like helical domain superfamily	Interproscan
IPR019734 all species →	Repeat	Tetratricopeptide repeat	Interproscan
IPR003347 all species →	Domain	JmjC domain	Interproscan
IPR048560 all species →	Domain	Lysine-specific demethylase 6A/B-like, GATA-like	Interproscan
IPR048562 all species →	Domain	Lysine-specific demethylase 6A/B-like, C-terminal helical domain	Interproscan
IPR051630 all species →	Family	Transcriptional Corepressor and Histone Demethylase	Interproscan
IPR046941 all species →	Homologous_superfamily	Lysine-specific demethylase 6, GATA-like domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR14017 all species →	LYSINE-SPECIFIC DEMETHYLASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0000978 all species →	Molecular Function	RNA polymerase II cis-regulatory region sequence-specific DNA binding	Interproscan
GO:0010468 all species →	Biological Process	regulation of gene expression	Interproscan
GO:0031490 all species →	Molecular Function	chromatin DNA binding	Interproscan
GO:0044666 all species →	Cellular Component	MLL3/4 complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K11447	UTX, KDM6A; lysine-specific demethylase 6A	EC:1.14.11.68	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074633558.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

65TPM > 0

2Conditions

44.7Max TPM

13.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	34	12.10	44.67
all_coral_tissue · baseline	38	31	15.62	29.98

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	44.67
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.92
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.27
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.27
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.04
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.10
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.58
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.38
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.08
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.85
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.98
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.89
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.01
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.01
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.15
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.96
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.75
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.00
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.24
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.20
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.21
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.10
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.13
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.59
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.69
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.47
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.45
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.93
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.91
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.07
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.97
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.79
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.77
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.13
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.98
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.87
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.02
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.91
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.74
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.48
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.19
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.66
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.56
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.50
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.49
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.17
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.16
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.59
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.36
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.24
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.38
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.33
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.13
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.36
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.44
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.15
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.93
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.88
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.46
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.71
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.66
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.52
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.38
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.77
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.54
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.