Gene detail

Detailed information of XP_074634271.1 in Acropora palmata

Genomic Location: NC_133890.1:5579611...5586522
NR annotation: XP_029207639.2, G patch domain-containing protein 1-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074634271.1

ATGGCTGACAGCGACGAGGAAGACAGTCTTGCTAGTTTTGGAACACCTTTTGAGCCTTTGGAAGAAGATGCTCCGCGAAAAAAAGCTATCCCAGTACACGAACAGATTGTTACAGATTCTGAAGGCAGGAGAAGATTTCATGGCGCCTTTACTGGGGGATTTTCTGCTGGTTATTTTAACTCTGTCGGAACTAAAGAAGGATGGCAGCCGTCAACTTTTGTATCTTCCCGTTCAAAAAAATTTGAGCCCAGAGCCCAGAGACCAGAAGACTTTATGGACGATGAGGATATGGGAGAGTTTGGGATTGCTCCCAAACGTATCACGACGACTGAAGAGTTTTTGCCAAAGGAACAAGAAAGTGAGAATCGCCGGAAGAGGATAGGGGCAAGTTGGGAGTCCCCTGGAGTTATTTCTGGGGATCGTGTATTAGAAGATCTTGTTTTACCAGTGAAGATGTCTGTTGGGGTCGAACTGTTGAAAAAGATGGGCTGGAAAGAAGGGCAAGGAGTTGGACCTCGTGAGAGGAAGACGAAGAAAAAGGTATATGGTTGTTCTCTTCCATCGTCATTGCAAACAGATGTCATTGAAGAGGAAGAAGATATCTTTGCTGTTGGTCTTCTTTTTGCACCAAAAGATACTGAAATCTTTACTTTCACACCTAAAGATGATAAACATGGGCTTGGCTACAAGGGATTGGATCCTTCAACAGCACTTTTTGGAAGAGAGGATGTACTTGGTATCAGTCCTGGGTCAAGAAAAAGTGGAAGGAGGGGCTTCTCTGGGGAGGCATTTGGTGTTGGTGCTTTTGAAGAAGATGATGGTGATATTTATGCAGCAGATCGCATGGCCAACTACGACCTGGAGCTAACCAGTGATCAGAGCACAGGTTTGCATGGCTGGACTGGCCCTCCCAAGGAAAATATGAGAGGTGGTGAATTGTCGATCTTCACTATCACTGCCAAACACATAGACTCCATTAAATCATTTCCCCCACCGGTTGTCCCCCGTGATTTCGACGGCAGTCACAAGTTCGACAATTTGACATCTCCCAAGGAGGCTTCACAAGAAGGGAAGACACTTACTGCTGCAGACAGAGGAGCAATGCTAGGAGAAGAACCACTTCCAACGCCGAAAAAGTCCGTTTTCGATTACATGTCAAAAGAGGACAAAGAGAGAGTCATGTCATCGAAGTTGGTGACACCCAAACCTGCCAGTACAGCATCTGCCACATCTACCTATTCTTCAGCAACTGTGTCTGCACCAAGGAAGTGGTCGTCAAACGTGCATTTTGGTTCGAACAGTTTCAAACCCTTTACGAAAGATCCAGCTAAACAGGCCAGATATGAGGAATTCTTAAAGGCGAGGAATACTGAACAGACTTGCGAGTCAAGCATTGACAGTGGACTGACAGAATGGGAACGAGAGCGAGAAAGAGAAGAATTTAGTCGCGCCGCGGCACTATACCAGCCTCTTAGCTCGACACTAGCGGCGCGATTTACTTCTGCAAAGCAGAAAGATGACCATACAACAGTTTACGAAGAGGTGCCAGCCCAGGAGGCTTCAGATATGTCCGAACAAACCAAAGCTGCCAGAATGAAAATGTTTGGAAAACTAACACGTGACACATTTGAGTGGCACCCAAATAACGTTTTGTGCAAGCGATTTAATATTCCTAATCCATATCCTGGGTCTGATGTCATTGGAGTACCAAAAATGCGAAGGCCCAAGTTTTCACTCGGTGATTTTTTAGCGTCACAAACTGAAAACCCGCGCGAAATACTAGCATCTAGTGAACTTGAGAAGGAAAGGCCCGGTAGCTCAGCGGGTCAAATTGCTTCACTGGAAGTCTCTCCGAAGTCTTCCGAACCAGCAGCTTCCGTTCCCGTAGAGACTGCGAGTACTGTGGTGACGAATGAAGCCATAACTATCGGTGATAAAACAAAACAAGATGATACTAACGCAGTCCCTCAGAGACCTCCCATGGATTTATTCAAAGCGATATTTGCTGATTCCTCGGAAGATGAATCCAACGAAAATGACAACGACGACGACGAAGAAACCGAAGTTCCTCCGAATCCGACCGAAAGCAAGACGACTCCTTCGTTTCAGGTCGCTGACCAAACTAATGCAGACAATAGCGTGTCAGACGTCTTCGCGGATCTCAGTGATACTTCAAAAGAAGTCTTAGCCAGTGGAAATGAGAAAGAAACTGAAACAACATTACATACTGATGTCCAGCAGCAGCTGGAATCATCTGATTTTCAGTATGGTCCGACCCTTCCGCCTGGCCTTCGTCACGGCGTGGCGTCCTTAGGCCGCGAAAAACGTTTCGAACACGGCAGTGGCGGTAGTTCAGAGCACAAAAGTCGCACGAAAGAACAAACGAATAGCACAAAAACACGAAATTCCGATTTTAAAACGTCGTCGCGTTATTCTTATGAAGAAAAACATTCGGGAAAGAAGATTCGTTGGGAAGATTCACAGGGTAATAGGCACATGAAAAAAGACATGGGTGGTAAACACGAGGGGACAGTGAGGAATTTCAGTGAGTCTTCAGATAGTGATGAGAATAACAGATCAAGACACAAACATAAACGAAAGGAGAAGAAACGCAGTCATCGGCATAAACACTCAAAAAAGAGCAAACATCGTGATGAAGAAAGAAACAGTGAGAAAAAAGTTTCTGAAAATCGGTCGAAACAATCAGCGCATGATAACACTGTGTCCAATGACAAGCAGATTCTCGACAAATTGAAGAACCTACAGAATTTAAAAGATGGGAAAAGAATGAAAGCGATTGATTTCATGTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q24K12	G patch domain-containing protein 1 OS=Bos taurus OX=9913 GN=GPATCH1 PE=2 SV=1
Q9DBM1	G patch domain-containing protein 1 OS=Mus musculus OX=10090 GN=Gpatch1 PE=2 SV=1
Q9BRR8	G patch domain-containing protein 1 OS=Homo sapiens OX=9606 GN=GPATCH1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0006908 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01585 all species →	G-patch	G-patch domain	Family	Interproscan
PF07713 all species →	DUF1604	Protein of unknown function (DUF1604)	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000467 all species →	Domain	G-patch domain	Interproscan
IPR011666 all species →	Domain	G patch domain-containing protein, N-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR13384 all species →	G PATCH DOMAIN-CONTAINING PROTEIN 1	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006397 all species →	Biological Process	mRNA processing	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K13123	GPATCH1; G patch domain-containing protein 1	-	Spliceosome	ko03041	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074634271.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

63TPM > 0

2Conditions

26.4Max TPM

8.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	35	7.55	26.39
all_coral_tissue · baseline	38	28	8.80	18.50

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.39
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.59
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.39
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.64
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.88
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.90
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.04
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.78
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.69
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.53
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.41
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.57
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.50
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.44
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.61
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.56
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.41
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.05
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.79
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.61
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.58
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.20
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.67
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.65
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.52
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.29
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.24
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.08
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.97
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.60
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.29
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.25
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.41
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.86
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.84
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.50
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.26
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.84
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.83
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.15
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.80
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.16
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.69
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.68
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.67
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.46
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.00
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.86
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.70
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.65
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.58
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.49
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.33
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.82
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.82
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.91
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.45
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.36
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.88
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.84
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.48
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.10
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.06
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.