Gene detail

Detailed information of XP_074634366.1 in Acropora palmata

Genomic Location: NC_133890.1:19073992...19086609
NR annotation: XP_029186140.2, integrator complex subunit 10-like isoform X2 [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074634366.1

ATGGCTGATAAGGCGGATACTTGCGAAGCAGATTCTCAGTGGTTAGTTGAAAGAGCAAGGCAAAGTTTGAGAGAAAATAACCCTTTTGAAGCTAAAGCTTGGCTGATAACTGCCAAGACGTTATACCCAAAAGATTTTGGAGTTCAGTATGAAGCCTACAGCATAGAAAGAAATGATGAGAGAGTACAGGAGGCAGCTAAACTATTCTACCAAATGTTTGAACAATTTCCAAGTAGTGATTTACTGTGGAAAGAGGTGGAAAATTTTACAAATGCTTTAGAGAGCGAGGTTGTGGATAAGCATAGCAAATTTTTAACAGACATGTTTGGCTGTCTACCACAACATGCACAAAGAGGGATACTTCTGCAAGCTGCAGGAAGATGTCAGGACTGCATTCATAAATGTAGAATGATGCTCCTTCTCATGAGAAGATTTCCTGATGTGATACCAAGGAATGGGGTCAATTTGACTGAAATGTTGATAGATGCTGGAAACAAAGAATATCCTAGTACACCAGTAAATCCATACAGGAAACTATTAGTGTGTGATGTCCTACCTCATCTACTGGCCAGCAATAATCTGAAAGTGGATGTTACAAGACAAAATGGAAAGGACCGTGACAGTCAAGATGATGAGGATGACTCCTCTGGAATCTCTGTATTTCAAGTATACAGGTGGTTGAAGCTGTCCATCCAGTTCTATGTTGCATGTGCTACTGTTCACAACTCAGTGCCTGAAGGATTTGATACTTCACATGGCAGTGCAGTTGACAACAGTATCATAGCAGAGGTTTTGGATTGCAAGGGACCCTGGGTTGCTCTTCATGAGCTGTTTTACTTGGTTGCAAAGAAGTGTGGCTGGATTGAAATTTGTAAAATTCATGACAGGCTCGATCCTCAAAAGTATCGAAGCAGTAGTGATCATTGGAGCAGTATTTCTGAGTTGCATCATAAACTGAAGAAGATGTTCAAACACAATTTAGAAGGAGACATTGAAAAGGACTTGCAGGAGAAGACTGGTGTGATGTTTGCTGTCACCATCCTATTTCTGCAGACTGTGTGGGAATACTGCCATGTGGTAAACAGGCTCGATTCAGTTTCCAGTTCAGGAGTGGTTCATCCTTTGGTTTTCATAGAGGATGTCACAGAAGATAATAAAAAGTCTTCAGAGGGAGGTGACACTAGTCCAGCACCAAAGAAGAAAAAGAAGAAGGTTACATCTAGTGGCCATGGCTCCCCGGGGAAGGAGGAGGGGAAGAGCAAACAGATGTTGCATGTGTTAGTTGATAAAAGTTGTGGTTCAGTCAACCAAAGCATATCAGATGACTTTTCTGTGTCTGTAGATGCATGGCATCTCCTGAACACATACACTGGCTACAAAACTGATTTCACTCGCCTTTCGGGAGAATGGAATATGGAGCGATGGACTTGGTTGACAACTTTTCATATTGACAGACTTATTTATAAGGGAAAATATAAAAAAGCGGTGGACTATCTACAAGAACAACGCTATTCTCTAGAGCAGGATACCTTGTCAAACCAAGAGCTGTTGGCAAGAGGTGCCGTTCAACTATCCTGTTGCTATTTCCAACTTGACGATAACAAAAGAGCCTGTGAAGAAGCACTTTATGCCCTCCAGTTGTTTTTATCCAGAGCCTCACCCGCAGATAACATTACACTAAAAAGATCGACGTCAGTTCATCAGGGGAAATTAGATTCCAGCGAGACAGAGCTTTCAACGACCTCATCATTGCAAGGTCGCTGTTTGAGGTTGATTCCATGCACCGAATCAGAAGTGGTTTCCTTTTCCGTTCGTCTACTGCTTTCGTCACTAAAGCAAAGGCTCGCGAGTGAAGGACGGAATGATACCCTCATCGGTCACCTGATTGTTTTACTGCAATATGATTGGCCCAAAGAAGAAGGGACGTTTTACGAGCTTCTTGAAAAGATCCGTGATAATAGGGGCCTGAAATACAGAGTGTTTTTCGACTATGTGAATAATATCGACATTTTAGAGGAATTTGCACATCTTTATAGTGACGCTTCTTATAACCTTGATCTTATTCCTGTCACTTCTTCTGGGTCCAGGGCGGTGACCCGAGGGGTAAACAAAGGAGTGAAGGAGGATTTCCGTGCTGCTCTGGAGAGACAAATATGTCGTAGTGATGACGGTTTTGAACCTTTTCTGAAAGCGTTTTTCCAAGACGAAAAGGAATCACTCCTCAGCTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5ZLS8	Integrator complex subunit 10 OS=Gallus gallus OX=9031 GN=INTS10 PE=2 SV=1
Q8K2A7	Integrator complex subunit 10 OS=Mus musculus OX=10090 GN=Ints10 PE=1 SV=3
Q9NVR2	Integrator complex subunit 10 OS=Homo sapiens OX=9606 GN=INTS10 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004113 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF21045 all species →	INT10	Integrator subunit 10	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR026164 all species →	Family	Integrator complex subunit 10	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR16055 all species →	UNCHARACTERIZED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016180 all species →	Biological Process	snRNA processing	Interproscan
GO:0032039 all species →	Cellular Component	integrator complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K13147	INTS10; integrator complex subunit 10	-	Spliceosome	ko03041	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074634366.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

51TPM > 0

2Conditions

16.5Max TPM

6.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	28	5.31	14.48
all_coral_tissue · baseline	38	23	6.80	16.48

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.48
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.50
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.08
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.81
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.69
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.17
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.06
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.05
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.69
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.60
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.84
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.25
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.23
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.15
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.96
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.88
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.19
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.51
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.29
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.19
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.03
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.90
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.63
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.39
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.01
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.67
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.41
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.79
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.48
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.13
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.86
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.49
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.44
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.97
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.84
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.58
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.46
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.96
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.95
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.06
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.02
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.85
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.43
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.96
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.91
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.64
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.44
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.21
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.01
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.27
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.26
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.