Gene detail

Detailed information of XP_074634367.1 in Acropora palmata

Genomic Location: NC_133890.1:18956136...18971732
NR annotation: XP_029186409.2, propionyl-CoA carboxylase alpha chain, mitochondrial-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074634367.1

ATGGCCACTGGAGGCGCGAAGTTTTGGATATCCTCACTACTGCGGAGCTCTTGCGAAGTTTGCAAGCTACATCAAAAGTCTTTGCTCAATGGCCATCAGATGTGGTATAGAGGACTGCGGACATCAGTTGGTCCAGAGGAAAAGCTTTTTGACAAAATTTTAATTGCTAACAGAGGAGAAATAGCGTGCAGAGTGATGAAGACTTGTAAGCGTCTTGGTATCAAAACTGTTGCTGTGTACAGTGAAGCAGATGCAAGTGCACTTCATGTTAAGATGGCTGATGAGTCCTTCTGTGTGGGCCCTCCACAAACCAATCAGAGTTATCTGAACATGGATGCCATCATGGATGCTATAAGCACTAGTGGTGCACAAGCGGTTCATCCAGGTTATGGATTCTTATCTGAAAACAGTAAATTTGTTGCCAGATTGGAGAAAGCAAATGTAGCATTCGTTGGTCCAAATGCTGCAGCAATGCAAGCAATGGGGGATAAAATTCAGAGTAAACTTATTGGAAAAAAGGCTGGTGTTAACATTATTCCTGGATTTGAAGGAGTTGTCAAGGATGATTTGGATGCTGTCAGAATAGCCAATGAAATAGGTTACCCAGTTATGATCAAAGCTTCCGCCGGGGGTGGCGGCAAAGGAATGAGAATTGCTTGGAATGATGATGAAACCAAGGAAGGATTTCGACTTTCCTCGCAGGAAGCTAGCTCAAGTTTTGGCGATGACAGATTGTTGGTGGAAAAGTTTATTGACAATCCACGCCATATTGAAATTCAGGTTCTAGGAGACAAGCATGGGAATGCAGTATATGTAAATGAAAGAGAGTGTTCTATCCAAAGACGAAACCAAAAGGTCATTGAGGAATCACCCAGCCCTTTTGTTGACCCTGATATGCGAAAAGCTATGGGCCAACAAGCCATTGCCCTTGCAAAAGAGGTGGGTTATGATTCAGCTGGTACTGTGGAATGTTTGGTTGACTCACAGAAGAATTTCTACTTCCTTGAAATGAACACCCGTTTGCAAGTAGAACACCCAATCACAGAAATGGTAGCTGGAGTGGATCTTGTGGAACATATGATCAGAGTTGCTGCAGATCATCCTTTGAACATAACCCAGGCAGATATTCCAATCAATGGCTGGGCAGTGGAATGTCGAGTTTATGCTGAGGATCCATACAAGAACTTTGGATTGCCTTCCATTGGGAGATTGTACAAATACATTGAGCCAACTCATATTCCAAATGTTCGCTGTGACAGTGGTATCATTGAAGGAAGTGAAATAAGTATCTACTATGACTCCATGATATGTAAGTTAGTCACTCATGAAAATACAAGAAATGAAGCCCTTGATACAATGAACAAAGCATTAGATTCTTATGTAATTAGAGGAGTCACATACAATGTTTCACTTTTACGAGACGTACTTAACCATCCCAAGTTTCGTAAGGGTGACATTACCACCAAGTTCCTTCCACAGGAGTATCCCAGTGGATTCAAAGGACATCAATTGACAGAGCAAGAAAGAGATGAATTGCTGGCAACCACTGCTTATTTCTTTGTGCAGAGAGCACTGAAAGCCCGAACATTTAAAAATCAAAGCAAGCTTAATGCTGTCAGTGCTAAACAAGATACCTGGGATCTCGTTATTTCCCTGAAAAAGGAAGACTACCCAGTGAATGTAAAATCATGCTCAGATGGCAGATTTGAGGTGAACATTGATGGGCGCACAGCAGACCTCATGACATCATCTGGCTTAGCAGATCCATTGTTTGAAGCTAAAATCAATGGAAATGATGTCATACTGCAGATGTTGAAAAAGAAGGGGAATCGTTTTGATATCCAACATTACGGAACAACGTATAAGCTTCGAGTGCACACACAGGAGCAGTATCAATACTTGGAATACATGCCTGAAATAAAAGAGGAGGATATGTCACCGTTTCTTAAGTCTCCAATGCCTGGTACAGTGGTGTCAGTTGCAGTTACCGTTGGAGATACGGTTCATGAAGGACAGGAATTAGCCGTAGTTGAAGCTATGAAGATGCAAAACAGCTTACATGCTGGTCTTTCTGGCACGATTAAAGCAGTGCACTGCAAGGCTGGAGACAAAGTAGGCGAGGGAGATATAATGGTGGAGATTGAAAGTCATCCGGATCATTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q91ZA3	Propionyl-CoA carboxylase alpha chain, mitochondrial OS=Mus musculus OX=10090 GN=Pcca PE=1 SV=2
P14882	Propionyl-CoA carboxylase alpha chain, mitochondrial OS=Rattus norvegicus OX=10116 GN=Pcca PE=1 SV=3
P05165	Propionyl-CoA carboxylase alpha chain, mitochondrial OS=Homo sapiens OX=9606 GN=PCCA PE=1 SV=4

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001401 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00364 all species →	Biotin_lipoyl	Biotin-requiring enzyme	Domain	Interproscan
PF02786 all species →	CPSase_L_D2	Carbamoyl-phosphate synthase L chain, ATP binding domain	Domain	Interproscan
PF00289 all species →	Biotin_carb_N	Biotin carboxylase, N-terminal domain	Domain	Interproscan
PF18140 all species →	PCC_BT	Propionyl-coenzyme A carboxylase BT domain	Domain	Interproscan
PF02785 all species →	Biotin_carb_C	Biotin carboxylase C-terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR016185 all species →	Homologous_superfamily	Pre-ATP-grasp domain superfamily	Interproscan
IPR000089 all species →	Domain	Biotin/lipoyl attachment	Interproscan
IPR005479 all species →	Domain	Carbamoyl-phosphate synthetase large subunit-like, ATP-binding domain	Interproscan
IPR050856 all species →	Family	Biotin-dependent Carboxylase Complex	Interproscan
IPR005482 all species →	Domain	Biotin carboxylase, C-terminal	Interproscan
IPR011054 all species →	Homologous_superfamily	Rudiment single hybrid motif	Interproscan
IPR011764 all species →	Domain	Biotin carboxylation domain	Interproscan
IPR011053 all species →	Homologous_superfamily	Single hybrid motif	Interproscan
IPR001882 all species →	Binding_site	Biotin-binding site	Interproscan
IPR013815 all species →	Homologous_superfamily	ATP-grasp fold, subdomain 1	Interproscan
IPR005481 all species →	Domain	Biotin carboxylase-like, N-terminal domain	Interproscan
IPR041265 all species →	Domain	Propionyl-coenzyme A carboxylase, BT domain	Interproscan
IPR011761 all species →	Domain	ATP-grasp fold	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR18866 all species →	CARBOXYLASE:PYRUVATE/ACETYL-COA/PROPIONYL-COA CARBOXYLASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0004658 all species →	Molecular Function	propionyl-CoA carboxylase activity	Interproscan
GO:0005739 all species →	Cellular Component	mitochondrion	Interproscan
GO:0046872 all species →	Molecular Function	metal ion binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01965	PCCA, pccA; propionyl-CoA carboxylase alpha subunit	EC:6.4.1.3	Valine, leucine and isoleucine degradation	ko00280	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074634367.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

59TPM > 0

2Conditions

20.8Max TPM

9.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	33	9.38	19.47
all_coral_tissue · baseline	38	26	9.07	20.78

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.47
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.80
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.01
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.34
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.01
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.76
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.70
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.41
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.38
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.94
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.77
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.62
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.08
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.06
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.73
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.32
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.28
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.20
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.20
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.33
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.95
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.94
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.44
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.06
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.96
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.65
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.16
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.57
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.94
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.84
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.66
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.60
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.48
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.78
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.07
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.31
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.65
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.56
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.21
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.52
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.46
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.50
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.22
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.98
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.97
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.90
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.58
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.32
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.19
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.62
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.56
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.45
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.16
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.72
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.57
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.56
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.51
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.55
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.76
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.