Gene detail

Detailed information of XP_074634828.1 in Acropora palmata

Genomic Location: NC_133890.1:21150227...21159227
NR annotation: XP_044179926.1, LOW QUALITY PROTEIN: arf-GAP domain and FG repeat-containing protein 1-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074634828.1

ATGGCTTCTGGAAGGAAAAAGCAAGATGAGAAAAATCTAAAACTTCTTCGAGATCTTGCGGCTCAACCACATAATAAAGTATGCTTCGATTGCGGACAGAGAGGACCTACATATGTGAACATGACAATAGGATCTTTCGTTTGTACATCTTGTAGCGGCATTTTACGAGGATTAAACCCTCCTCACCGAGTAAAATCAATTTCGATGACTAGCTTTACTCAACAAGAAATTGAGACTCTACAAGGGCAAGGAAATGAGTATTGTAGAAAAGTTTGGCTGGGTCTGTGGAATTCATCTATGCCAGCAGAACCAGAGTCTCGTGATGAGCAGAAAAAAAAGGATTTCATGGTGCAGAAATATGAACGGAAAAGATGGTACGTCGCACCTCAGCAAGTTTCTGCCAACAATACCAGTCAGTCCACACCTGAACCAAAACCATTAAAACAGCTTCTGGGTGAAAATGCTCCTACTATATCAGTGCATGCTCAGACCACAAGAGAAAGACCTCGTACAGGAAGTCAAACAAATTCAACTTCGGTACCAGTGTCAGTTGCCCCTCCACCAGGGCAAGCACAGCCAGTAGCCCATAAAGTAGTAGCACAACCAGCACAACCAGTACAAGTACCAGCACCAGCACCGCAGGCAAAACCACCATCTATAGATTTACTTAGTGACTTAGGGGGAGATCCATTTGATCAAAAACAGACTCAAGCCCAGTTTGCAACAACCCCGCAATTTGATGCATTTGGAGCACAACCCACAGCCACTGGTCAAAATACATTTGATCCCTTTGGATCTACAGCACCTCAACCTGCCCAGCCCACAGAGTCAGGTTTTGCAACATTTGGTGGCCCACCACAGCAACAGCCGCCCAATTTCTTTGATGCATTTGGATCACCACCTTCATCCTCGGGGGGATTCAATGCATTTGCAGCTCAGACTTCGACAGCTTCTTCACAGCCACAAGCAGCATCTAATTCTGGGTTTGGGCCTCTAGTTTCTGCCTCTGGGAGTTCTGCATCAACAGGGGACAAGTATGCAGCACTTAGTGGGTTGGATGGTTTGTTTGCTTCCTCAGTTGGTGGAAGCAGTAACACCAGTATAAGTTCTGCATCAGGTTTTGGTTCTACTGGAACCTCATCATTTGGCATGTCAAGTGGACCCAACCCTTTCTCAAGCACATCAGGTGCAGGAAGTGGAGGCTTTCAGCAGGCTCAACAGCAGCCGTCTAATCCATTTCAAGGCCTTGGCGGCCAGCTCAATGGTCCTGCAAGAAACATGAGCACTGCCAGTAGTATGTCATCAACATCTGGTGTAGGAGGCGGGTTTGGAAGTTTCAATAGTGCTCCGCCAATGGGTTCTGCATTTGGCAGTCAGCCAGCCACTTCAGGATTTGGCAATCAGCCTGCCACTTCAGGATTTGGTAATCAGCCTGCCACTTCAGGATTTGGCAATCAGCCTGCCACTTCAGGATTTGGTAATCAGCCTGCCACTTCAGGATTTGGCAGTCAGCCTGCCACTTCAGGATTTGGTAATCAGCCTGCCACTTCAGGATTTGGTGCCCAACAACCCAATTCAGGGTTTGCAGGGGGTAATCAGACTGGTGGAGGTTTTGGCAACTTTGTGTCTGGCCAACAGTCATCATATGGTGCAACACGTCAGCCTGGTTGGGGAGGCATGTCTGGCCAGCAGCAGATGGTAGGAGGTCAGAACGTAGGGATGGCTTCATCTTCACCTCAACAAACACTCAGTTTTGGAGGTGCTGGGATGAGTGCAATGGCATGGACTCAGTTTGGCAAGATGGGTGGTAGTCAACAACAACAACCACAGCAACCTCAAATACAAGGTCAAATGAACTTTGGTGGCAACCAAACTGGCTTTGCTGGCAACACAGCATTTGGTGCTGTACAATCAAATGCTGGGTTTGGGTCAAATGCTATGTCAAGTGGCAATAGCTTTGGAGGTCAACCACAAGTTGCCGGGTTTGGAACCTCTGGATCATTTGGTGGACAACCATTAAGTGGTTTTGGGAATCAGGGTGGAGGAGGATCATTTGGTGGTAGCATGTCAATGATGGGAGCTGGGCAGTCTGGACAACAACAACAGCTACAACAGTTTGGTAGTTGGCAACAGAGTCAGCAGGCAAATCCTTTTATGAATGCCAGAGCTCAAGGCATTCAAAGACAGGGACAATCTACGAACCCTTTCATGTAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P52594	Arf-GAP domain and FG repeat-containing protein 1 OS=Homo sapiens OX=9606 GN=AGFG1 PE=1 SV=2
Q2TA45	Arf-GAP domain and FG repeat-containing protein 1 OS=Bos taurus OX=9913 GN=AGFG1 PE=2 SV=1
Q8K2K6	Arf-GAP domain and FG repeat-containing protein 1 OS=Mus musculus OX=10090 GN=Agfg1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0007317 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01412 all species →	ArfGap	Putative GTPase activating protein for Arf	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR038508 all species →	Homologous_superfamily	ArfGAP domain superfamily	Interproscan
IPR001164 all species →	Domain	Arf GTPase activating protein	Interproscan
IPR052248 all species →	Family	Arf-GAP domain and FG repeat-containing protein	Interproscan
IPR037278 all species →	Homologous_superfamily	ARFGAP/RecO-like zinc finger	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46134 all species →	DRONGO, ISOFORM F	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005096 all species →	Molecular Function	GTPase activator activity	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K15044	AGFG1; Arf-GAP domain and FG repeats-containing protein 1	-	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074634828.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

73TPM > 0

2Conditions

126.9Max TPM

50.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	41	47.14	126.92
all_coral_tissue · baseline	38	32	53.51	96.21

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	126.92
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	114.22
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	105.53
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	93.19
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	82.56
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	79.74
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	78.79
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	77.54
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	76.69
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	75.24
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	72.65
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	69.39
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	68.69
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	68.64
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	68.03
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	66.65
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	65.29
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	64.46
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	63.57
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	63.42
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	59.94
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	55.78
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	54.12
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	52.55
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	48.22
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.28
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.80
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.38
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.56
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.41
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.83
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.79
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.21
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.75
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.44
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.81
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.87
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.74
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.68
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.01
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.87
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	96.21
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	85.32
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	85.14
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	84.68
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	84.53
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	84.22
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	81.58
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	80.19
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	79.95
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	79.20
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	79.14
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	78.09
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	77.14
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	76.95
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	75.36
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	74.65
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	73.23
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	71.09
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	70.02
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	68.84
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	66.09
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	62.15
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	61.65
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	60.63
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	42.18
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.81
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.50
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.00
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.78
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.74
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.53
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.94
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.