Gene detail

Detailed information of XP_074635565.1 in Acropora palmata

Genomic Location: NC_133891.1:21592180...21614561
NR annotation: XP_044174098.1, protein HIRA-like isoform X1 [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074635565.1

ATGAGATTGCTAAAGCCTAGCTGGGTTTCACACGAAGGAAGACCTCTGTTTTCCATAGACATTCACCCTGATGGCTCTCGCTTTGCTATTGGTGGTCAAGGAGATGACTCTGGCAAGGTTACTATCTGGAACATGGCACCTGTAAAAAATGAGGAAGATGAAATGAATGAAAATGTGCCAAAGTTGTTGTGTCAAATGGATAACCATCTTGCTTGTGTTAACTGTGTGCGCTGGTCCTGTGGTGGTAAATATCTTGCTACTGGTGGAGATGACAAACTCATTATGATCTGGCAAATGGCAAGGTATTTGGCTCCCACGGCAGCATTTGGAGGAAACAGTGGCAAGTCAAATGTTGAGCAGTGGAGATGTGTGTACACCTTACGAGGGCACACAGGAGATGTGTTAGATCTTGCTTGGTCGCCAGACGACAGTTTCTTGGCTTCTGGAAGTGTTGACAACACAATCACAGTATGGAATGCTCAACGATTTCCAGATATTGTGACTGTTTTAAAGGGACATAGTGGGTTGGTAAAAGGAGTCACATGGGACCCAGTTGGGAAATACCTGGCCTCTCAATCAGATGATAAAACTTTAAGGGTGTGGCGTACATCAGATTGGCAGCAAGAGACTTTTGTCTCAGAGCCATTTGCTGATTGCAGTGGAACAACTCATGTTCTGCGGCTTAGTTGGTCTCCAGATGGTCACTACGTTGTATCAGCACATGCCATGAATAATTCTGGGCCTGTAGCTAAGATCCTGGAGCGGGACGGCTGGAAGATGAAAATGGATTTTGTGGGACATAGAAAAGCTGTCACATGTGTGCGATTTAACCCCAAGCTGTTTGTAAACAAATTGAGTGAGGATTCAGCCAGGCTCAAGCAATATTCCTGTTGTGCCATTGGAAGCAGGGACAGATCTCTTTCTGTTTGGTTAACATCTCTAAAGAGGCCTCTGGTTGTGGTACATGACTTGTTCAATCACTCTATCATGGATGTCTCATGGAGTGAATCAGGATTTCAGCTGTTGGTTTGCTCCTGGGATGGAACAATAGCTTATGCAGATTTCACAACTGAGGAACTTGGCAGACCAATGTCTGAGGAAGAGAAGGAAAAATTCCACAAACAAGTTTATGGTATCAGCATAAGTAGCAGCAAGTCAAACTTTGCCAGTGCAATTATTGAAAATCCCGAGATGCTCAAAATCCAACAACGACATGTTATGAAACAACAGACTCTTGCCAGTACAAATAAACCCAATGCACAACCTCCCCCTCTCGTATCTGCTACAGGGACACCAACAAAACAAGAACCTTCTTCTACAAATGGAAATCTAAGCAGAAGTCCATCAAATGCAAGTTACTTAACCAGTCCGGTGGCAAAAAGCCCGTTGGATCCTGATAATGTCCGACAAAAGCAAATAGAAACGAGAACTAAAGATGGTCGCCGTAGGATCACTCCTCTGTTGGTGTCCTCCATGGAAGTAAGTGATTCGCCCATGCCGTTTGGAGTTTCTTCAGCAGCAGTTTCCACATCAGCAAGTTCTAACATTTCTCAGACAGCTTCATCCATTCCAACAACTCAGAATTTGGTGGCACTGGATTCAAGAATCGGTGAAAATGCCACTACTGGATTCACGAGCAAAACTAGTGTGGACAAAGTGACCGAGAAGATGGAGATGGCATTTGTGAAGCCGGTCTCCGCAACAACAATGAAGCCCATGATGTCATCAGTTAAGTCGGCATCCAGTACCTCTGTGACAACTTCGGCGGCTACAACTACAAGCACAACGATTGCTGTAAAGAGAAAACCAGACACTCATGCGGCATCGCACTCAAAAAGAGCAAGGAAGGATGGAAGCTCATCTGGCAGAAGTTCAAGTAGTTCTAGCGCTAGTAAACAACGTGAAGATAGAACGGATCTGGAGGAAGCTTCTGACGCTTCTTTACATGTTCGACATTCCGTGGCGATTCCTTATCCAGTTCCTCAGAAGAATCTCTCAGTTCAGATAAAGGGGTCTGGTGGTGAAGGAGCCTTGTCACTGGACTTAGACAACAATTTAGCAAGTCAAGGGCCCAGAGTGCATGTCTTAAAGTGCTCTACCGCTGGAAAGCCCCTCTGGGAAACTGTACTAATGAGCCCCGGTATTGCTTTGGCTGGAAATAGACAAGTGATATGCGTAGCCTGTGAAAACAGAAGTATTAACCTGTTTTCTTCCGCCGGCAGAAAACTGCTGTCTTCCATTGTGCTTGATTCACCGGCCTCCATCTTGCAGTGCAGCCGCCATTACGTCATGGTTGTAACTTCTGCTGGAGGAGTGTACATTTGGGACACGAAGCGTCTAAAAGCAGTGCTTAAAAATGAACCAGTTGTTCCCCTCTTATCAGGTCCTGATATCACCATCACACGAGCCTCGATTTCAGAACCAGGATTTCCCATAATCACTCTCTCCAACCATGCTTCTTATTCCTACGACACATCCATAGGGGCCTGGCTCCAATTGATTCATGCTGATGACCTGTTGGCTGTTAACTCCGACCACCAATCCGTTACACCTTCCCAAGATCTCTTGCAGGCCCAGGGCCCACTAGCTCAGCTCCAGGGACAAAGTTCTAGATTCGGACGTCAGTCTACAAGACTTTTTCGTTCCAATCCTGGCCGACAACAATCCTCTACAGCTGTTTATTTGGAGAACCAGTTATCATCTTGCGTGGCTCTTGGTTCTGCGAAAGAGTACTACCATTGGCTAACCACCTACATACGCTATCTTTCTCAAGCTGGTTTTGAGGCTCGATTGCGTGAAGTTTGTGAGGAATTACTCGGCCCACCCCACAGAACGATCAGTCATCAGGACAAAACGTCCAGCTGGAATCCCTCTGTACTGGGATATCAGAAGAGAAGTCTCTTACGCCAACTTCTACCTCATATAGGAACAAACATTCGTCTGCAGAGACTTTTCACAGAATTCAAGGAACAGCTGGATGCGCTTAATGTGCGGTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P79987	Protein HIRA OS=Gallus gallus OX=9031 GN=HIRA PE=1 SV=2
Q61666	Protein HIRA OS=Mus musculus OX=10090 GN=Hira PE=1 SV=3
Q8QFR2	Protein HIRA OS=Xenopus laevis OX=8355 GN=hira PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004897 (this species only)
Ubiquitin family	UBD\|Other\|Beta-prp · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 adaptor Cullin RING\|CDC20 · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 adaptor Cullin RING\|DWD · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00400 all species →	WD40	WD domain, G-beta repeat	Repeat	Interproscan
PF07569 all species →	Hira	TUP1-like enhancer of split	Family	Interproscan
PF09453 all species →	HIRA_B	HIRA B motif	Motif	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001680 all species →	Repeat	WD40 repeat	Interproscan
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan
IPR031120 all species →	Family	WD repeat HIR1-like	Interproscan
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan
IPR020472 all species →	Repeat	G-protein beta WD-40 repeat	Interproscan
IPR011494 all species →	Domain	Protein HIRA-like, C-terminal	Interproscan
IPR019015 all species →	Conserved_site	HIRA B motif	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR13831 all species →	MEMBER OF THE HIR1 FAMILY OF WD-REPEAT PROTEINS	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0000417 all species →	Cellular Component	HIR complex	Interproscan
GO:0000790 all species →	Cellular Component	chromatin	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006325 all species →	Biological Process	chromatin organization	Interproscan
GO:0006336 all species →	Biological Process	chromatin organization	Interproscan
GO:0006338 all species →	Biological Process	chromatin remodeling	Interproscan
GO:0006351 all species →	Biological Process	DNA-templated transcription	Interproscan
GO:0031491 all species →	Molecular Function	nucleosome binding	Interproscan
GO:0006355 all species →	Biological Process	regulation of DNA-templated transcription	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K11293	HIRA, HIR1; protein HIRA/HIR1	-	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074635565.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

63TPM > 0

2Conditions

17.9Max TPM

8.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	34	7.68	16.06
all_coral_tissue · baseline	38	29	9.83	17.87

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.06
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.78
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.74
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.44
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.13
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.77
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.32
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.21
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.57
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.87
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.84
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.80
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.74
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.55
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.21
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.19
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.10
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.98
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.57
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.36
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.84
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.79
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.71
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.36
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.51
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.36
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.12
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.85
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.50
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.40
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.06
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.75
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.50
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.30
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.87
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.15
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	17.09
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.69
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.50
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.49
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.47
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.94
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.91
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.46
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.16
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.84
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.50
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.79
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.28
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.04
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.93
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.85
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.36
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.35
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.06
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.46
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.36
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.92
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.87
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.74
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.34
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.83
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.16
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.