Gene detail

Detailed information of XP_074635584.1 in Acropora palmata

Genomic Location: NC_133891.1:18836848...18862136
NR annotation: XP_044174136.1, thrombospondin-2-like isoform X1 [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074635584.1

ATGGGATGGTGTGGAAAGTACTATTTTCAGAATTTACAACATGAGGATGGTAACAACAGTGTTGAAGCAGAACAGGAATGGCAGAAATCTGTACATGTTATTGAGCAAAAGCGTAGAAGAAAAAGGCTTCTCTTCATTGCTTTGGTGGCTTTGATAACTATGGGACTTCTAGCTCTGACAGCAGCTATTCCATTCTTGCTGGGGTCTAAGACAGCATATCCTGACTCAGGCAAGTCAGGGGTAAGTGAAGCAAATAGGAAACAGGTCAAGTGCCAGGAGTTGTCTCATGATGTGTCAAATGGCCATCTGGTTTGCAATGGAATAGAGATCAACTCCACCTGTTGGACTGTTTGCATTGAAGGATATGAGAAGGAAAATGAACAAATCGGAAATTTGAAATGTCTGGAAAATGGAGAGTGGGATGGGAAAAGAACATCATGTATGAAAGAAGGTTGTGGGGTATTTCAAAAGGTGTCAAATGCAGTGCATAATTGCACAGGTACAAATTACAGAGACAGCTGTGAAGTTACCTGTGTTGAGGGATTTGAAAGGAAAAATATTCTGGCTGGGAAATTCTTTTGTCTGGACAATGGAAGGTGGATTGGCGAGGAAACAGTTTGTGCCCCAAAAGACTGTGGATCCCCACACAATGTGCCTATCCCTGGGGAGTTCTACAACTGCAGTGGAACAAAATACAGCGACACCTGTGAGGTGGAATGTCATCAGAATTTTAACAAAACGGTTTCTGGCGTAAGGTGTGGTCCAGATGGGAGATGGAATACACAGCTGTTTGTAGTTTGTGTAGCAGCTGATCCTTGTATCTCATGCAACAAAGTGAATGGTTCATGCATGCAGCTGCCACACAATCCACAAGCTTTGTGCCAATGTAAGCTGGGATTTGCTGGAAATGGTGAACAGTGTGGACAAGATTCTGACATTGATGGCTTTCCTGATCATTCGCTGTCTTGTTCTGATCAACACTGCAAGATTGACAACTGTCCGTCAATCCCAAACAGTGGACAAGAGGACAATGATGGAGATTACTTTGGTGATGTTTGTGATGATGATGATGACAATGACAATGTGACTGATGCCATTGATAACTGCAAGTTGAAAGCCAACCTTGGCCAGGAAGATCAGGACAAAGATCGCATTGGAGATGCGTGTGACAACTGCATTAATGTTTCTAATTTTGATCAGAAAGACACTGATGGTGATGGTGTCGGAGATCTTTGTGACAGTGACCTGGATAATGACAGCGTAAAAAAGGAAGATAACTGTCCTTCAGTATTTAACCCAGGTCAGAGGGATACTGATGGGGATGGTGTGGGAGATGCCTGTGACAACTGCGTTAACATGTCCAATGCTCAACAGTTGGATCTTAATGACAATCTTATTGGTGATGTTTGTGAAGATAATGTAGACCAAGATCAAGATGGCATTCCTGATAGTATAGATAACTGTCAAGCTTTAGCCAATGCAGATCAACTTGATAGCGAAAATGACAAGGTTGGAGACAGCTGTGACAATGATAAGGATGGAGATGGTGTTTTGAATATTTTTGATAACTGTCCTCTTGTATCAAATGCCGATCAGGCAGATGTTGATGGTGATGGTGTTGGAGATGTTTGTCTTGGTGACACAGATAGTGATTCTGTCTTTGATTATCAGGATGACTATCCAGTGAACAAATTCTTGAATCAAACTGACTTTAGCCATTATCAGGAGATCATTTTGGATGGCATTGGGAAAGCACAGAGACCTCCAAAATGGAAAATTTTCAACAAAGGGCGAGAAATTGTACAGTCTGTAAATAGCAACCCAGGCTTGTTGATAAGCTACACAAAATTTGGGCATGTAGACTACAGTGGAACATTCTTTATATCTGATACAAGGGATGATGATTTTGCTGGAATTGTTTTTGGTTACCAGAGTAACAGAAAATTCTATGTTTGCTCCTGGAAGAAAAAGACACAGTCCTACAATTTAAACAATGAAGCAACTTTCCCAAGACCTGTTGGCAGAAAAGGAATAAACTTGATGGCCATTGAATCAAGTACAGGTCCTGGCATCAGCTTGAGAGATGCACTGTGGGAGACAGGAAACACCATCAATCAGACACATGTCCTGTGGTATGATCCCACTCCTCAGTGGATTAGTAATGTTGCTTACCAGTGGAGACTCTTGCATGATCCAGACTCTGGAAGAATTCGCATGCGCTGGTATAAGGGAGATGAACTTTTATCGGACTCTGGAAACATAATTGACACGAGATACAGAGGTGGTCGATTAGGCATGTACGTCTTTTCACAGACAGACGTCCACTATTCAGCTTTAGCAGCACGCTCTCCTGAGATCACAGACTATGCCCTTAGCCTGAATGGGAAAGATGCTTATGGTAATTTAGGAACTATTGGCAACATCACTGGAGAGTCTGGCAGCTTTACCCTAGCTGCTTGGGTGTGGATAACAGGTGCAAATGGAGGAATTATTTGTGACCTTCCTCTAATCACGTTTGGGGAAAAGACTCCAGATAAAGGATTCTTGAGGCAGTCTTCTGATGATGAAAAGGACTTCCTTGTGATTTCAAGTGGTACTCCATCTGGAAGTACTGGCCCATCTTCTGACCATACTACAGGCACTGGGTACTATGGTTACTTGGAAGCTTCAGGCGTTCGAGTGGGATCGAGGGCGTCATTTGAGACTCCTTGGTTTGCAACTGGCAGTGGCTGTAACATGAGCTTTTTTTACCACATGTCAGATCGTCATCCAACACGCATCAACATGGGAACCCTTCTTGTGGAAGTCAAGACTGTAGATAAGACATGGTTTGCAGTGTTTTGGAAAGCTGGAGATCAAGGTGACCAATGGCACCAAGGACATGTGGATCTTTCGATGTATAAAGGACTAGTGGCCATACGATTCACTGCTGCAAGAGGGAAGGCATATTACAGTGATATTGCTCTTGATGACATCTCATTTAGTTCTAGTTGTGGTTCCGTGAGAGCTTGTAACGACAGCCAAGAAATTCCCATTTTTGGTACCAAACAAGGCTCGAGTATACATTTGTCAGTAAGCGGTGGGAAGGCCAAAGGTGGAATAAATGGGAATCAGCTCCTGACTGGGAACTTTACATACAACACTTGGACACATGTTGCTTTGCAGTACAACAATTATACACAAAATCAGATCCTGTTTGTTAATGGGAAGGTTGAACAAGTCATGAGCAGAATTTCATCTCCTTATGGGAAATCCAATGTTTACTTAGGATTGAATGGTGCAGAGTACTTCATGGGACAGATTGACGAGGTACAAGTATGGGACACTGCTGTCAATGTAACATTGTACTATGACAAGTATTTGAAAGGCCAAGAACAAGGACTCGTCGGATACTTCCGTTGCAATGAAGGAGACGGCAATGAATTGACGGATGGTTCATTGTCAAGAAGCCATCGCATTCTTAACGGAACAAGATGGGTGTCATCATCTCTGGAGCTCACTTACATGAATTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P07996	Thrombospondin-1 OS=Homo sapiens OX=9606 GN=THBS1 PE=1 SV=2
P35441	Thrombospondin-1 OS=Mus musculus OX=10090 GN=Thbs1 PE=1 SV=1
Q03350	Thrombospondin-2 OS=Mus musculus OX=10090 GN=Thbs2 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004174 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00084 all species →	Sushi	Sushi repeat (SCR repeat)	Domain	Interproscan
PF13385 all species →	Laminin_G_3	Concanavalin A-like lectin/glucanases superfamily	Domain	Interproscan
PF05735 all species →	TSP_C	Thrombospondin C-terminal region	Family	Interproscan
PF00629 all species →	MAM	MAM domain, meprin/A5/mu	Domain	Interproscan
PF02412 all species →	TSP_3	Thrombospondin type 3 repeat	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000998 all species →	Domain	MAM domain	Interproscan
IPR035976 all species →	Homologous_superfamily	Sushi/SCR/CCP superfamily	Interproscan
IPR013320 all species →	Homologous_superfamily	Concanavalin A-like lectin/glucanase domain superfamily	Interproscan
IPR000436 all species →	Domain	Sushi/SCR/CCP domain	Interproscan
IPR017897 all species →	Repeat	Thrombospondin, type 3 repeat	Interproscan
IPR008859 all species →	Domain	Thrombospondin, C-terminal	Interproscan
IPR000742 all species →	Domain	EGF-like domain	Interproscan
IPR028974 all species →	Homologous_superfamily	TSP type-3 repeat	Interproscan
IPR003367 all species →	Repeat	Thrombospondin, type 3-like repeat	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10199 all species →	THROMBOSPONDIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0062023 all species →	Cellular Component	collagen-containing extracellular matrix	Interproscan
GO:0005509 all species →	Molecular Function	calcium ion binding	Interproscan
GO:0005576 all species →	Cellular Component	extracellular region	Interproscan
GO:0007155 all species →	Biological Process	cell adhesion	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for XP_074635584.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074635584.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

68TPM > 0

2Conditions

49.4Max TPM

18.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	36	18.89	46.62
all_coral_tissue · baseline	38	32	18.07	49.42

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	46.62
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	42.80
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	41.70
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	40.84
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	40.12
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	38.34
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	37.68
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.76
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	34.49
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.38
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.29
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.48
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.33
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.91
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	29.12
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.51
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.79
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.30
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.75
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.61
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.56
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.37
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.67
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.19
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.56
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.23
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.86
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.58
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.52
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.37
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.59
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.53
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.90
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.01
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.61
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.69
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	49.42
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	37.46
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.07
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.00
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.94
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.69
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.04
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.02
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.98
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.98
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.72
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.89
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.67
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.27
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.13
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.96
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.34
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.93
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.06
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.92
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.56
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.89
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.18
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.94
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.70
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.96
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.14
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.99
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.24
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.13
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.12
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.31
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.