Gene detail

Detailed information of XP_074635658.1 in Acropora palmata

Genomic Location: NC_133891.1:16946615...16966592
NR annotation: XP_029185342.2, acetyl-coenzyme A synthetase, cytoplasmic-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074635658.1

ATGGAGTCTTCTCAAAACGAGCACGAAAAAGAGCTTTCCGGATGGTTTTATCCTTCGGATAAAATGAAGTCCGAGGCGTATGTGTCCAGCATGGATAACTATAAGGAAATGTACACGAAATCCATCGAAAATCCAGCTGAATTTTGGGGAGACTATGCGAGCGAGTTCTTCTGGAAAGTTTCACCAAGCAAGGATCCGGACAAGTTCATGCGTTTCAATTTTGATACCAAGAAAGACAGAGTCCTGATCAAATGGATGGAAGGAGCTGTCACTAATATCTCGTACAATCTGCTGGACAGAAATGTGGGAAGAGGACTCGGTGAAACTGTAGCGTTTTTCTGGGAAGGGAATTCACCTGAAGATAGCAAGCAAATCACCTACAGAGAACTGTTATCTGAAGTATGCAAGTTTGCTAATGTGCTGAAAGACAAAGGCATCCAGAAAGGAGACCGTGTTGCAATCTACATGCCAATGATCATTGAGTTGGTGGTTGCTATGCTTGCCTGTGCAAGAATAGGAGCTGTGCATTCCATTGTGTTTGGAGGATTCTCAGCTGAATCATTAGCTGAAAGAATTCTTGACTCCACTTGCAAGATACTCATCACTGCTGATGGTTCTTACAGAGGGAAAAAGCTCATTAACTTAAAGGAGATTTCTGATGATGCCATAGCCAAGTGCAGAGAAAAAGGTGTAAGTCTGGAGAGCTGTATCGTAGTTCAGCATGTTGGAGGTGACTCAAAGAATGGTTGTGCATCACCTGTGTCAAAGAAACCTTGTCCAGATTTAAAGACAAATTTTGATGAAAGTGGGATTGATTGTTGGTGGCATGACCTGATGTCATTAGCAAGCGACAAGTGCGAACCATGCTGGACAGATGCAGAGGATCCCTTGTTCATGCTTTATACCAGCGGATCAACAGGAAAACCAAAAGGAGTTCTGCACACAGTTGGTGGCTACATGCTGTACACTGCTTGCACATTCAAGTATGTATTTGATTATCACCCTGGTGAAGTTTATTGGTGCACTGCAGATATTGGCTGGATTACTGGACACAGTTACATAACATACGGTCCGATGGCAAATGGTGCGACGAGTGTGCTGTTTGAAGGAACGCCTTTTTACCCTGACTCTGGTCGTTTCTGGGATGTTGTTGACAAGTACAAGGTGTCCAAATTCTACACTGCTCCCACAGCTATCAGAGCTCTCATGAAATTTGGAAAAGCCGTCGTCAACAAGTACAACCGCAAGTCTCTCAAAGTTCTTGGAACTGTAGGAGAACCAATTAATCCTGAGGCTTGGCTGTGGTATTACCGCACTGTGGGCGATGAAAGGTGTTCAATTGTGGATACATACTGGCAAACGGAGACGGGTGGTCATGTCATTACACCTCTTCCTGGAGCAACACCCATGCGACCAGGCGCTGCATCTTTTCCTTTTTTCGGTGTCGTGCCAGCCATTGTTGATGAACAAGGGAATGAACTTGAAGGAGCTTGTGAAGGATTTCTGGTGATGAAACAAGCCTGGCCAGGAATGGCAAGAACAATTTATGGCAACCACGAGAGGTTTGAGGAGGTCTACTTTTCCAAGTTCCCTGGTTACTACACGACAGGCGATGGTTGTAAGCGCGACAGTGAAGGCTTCTACTGGATCACCGGACGCACTGATGACTGCATGAATGTCTCTGGTCATCTGTTGAGCACTGCGCAGATTGAGAGCGCGTTGGTTGAGCACAACGCCGTCACCGAGGCCGCCGTCGTGTCTTGTCCGCATAAATACAAAGGAGAAGGGATATATTGCTTCACAACTCTGATGGAGGGGGTGGAATTCAGTGATGAGCTCAAGAATGAACTCAAAGTAAAAGTTCGTACCAAAATTGGGCCATTTGCTGCACCAGACGTTATCCAAAGTGCACCTGGACTTCCAAAGACTCGGTCAGGAAAAATTATGAGACGGGTTTTACGGAAGATAGCAAGAAATGATCGCAACATTGGTGATATAACAACAATGGCTGATTCCACCGTGGTTGAAACCTTGTTCGAGAACAGACCTCACGTTGACTTCATGCCTGAGTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9QXG4	Acetyl-coenzyme A synthetase, cytoplasmic OS=Mus musculus OX=10090 GN=Acss2 PE=1 SV=2
Q9NR19	Acetyl-coenzyme A synthetase, cytoplasmic OS=Homo sapiens OX=9606 GN=ACSS2 PE=1 SV=1
Q9VP61	Acetyl-coenzyme A synthetase OS=Drosophila melanogaster OX=7227 GN=AcCoAS PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000999 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00501 all species →	AMP-binding	AMP-binding enzyme	Family	Interproscan
PF16177 all species →	ACAS_N	Acetyl-coenzyme A synthetase N-terminus	Family	Interproscan
PF13193 all species →	AMP-binding_C	AMP-binding enzyme C-terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000873 all species →	Domain	AMP-dependent synthetase/ligase domain	Interproscan
IPR045851 all species →	Homologous_superfamily	AMP-binding enzyme, C-terminal domain superfamily	Interproscan
IPR020845 all species →	Conserved_site	AMP-binding, conserved site	Interproscan
IPR011904 all species →	Family	Acetate-CoA ligase	Interproscan
IPR042099 all species →	Homologous_superfamily	ANL, N-terminal domain	Interproscan
IPR032387 all species →	Domain	Acetyl-coenzyme A synthetase, N-terminal domain	Interproscan
IPR025110 all species →	Domain	AMP-binding enzyme, C-terminal domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24095 all species →	ACETYL-COENZYME A SYNTHETASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003987 all species →	Molecular Function	acetate-CoA ligase activity	Interproscan
GO:0006085 all species →	Biological Process	acetyl-CoA biosynthetic process	Interproscan
GO:0016208 all species →	Molecular Function	AMP binding	Interproscan
GO:0019427 all species →	Biological Process	acetyl-CoA biosynthetic process from acetate	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01895	ACSS1_2, acs; acetyl-CoA synthetase	EC:6.2.1.1	Lipid biosynthesis proteins	ko01004	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074635658.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

77TPM > 0

2Conditions

118.2Max TPM

52.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	41	47.59	118.22
all_coral_tissue · baseline	38	36	59.12	116.99

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	118.22
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	86.85
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	75.03
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	72.66
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	72.06
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	69.73
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	65.62
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	65.53
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	62.45
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	62.35
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	61.48
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	60.59
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	60.31
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	59.61
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	59.25
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	57.92
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	56.52
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	56.01
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	54.93
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	54.08
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	53.35
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	52.95
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	52.70
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	52.43
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	52.22
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	51.69
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	49.69
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	49.19
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	48.29
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	46.24
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	45.97
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	42.66
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	42.37
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	36.93
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	36.24
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.54
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.12
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.09
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.56
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.95
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.61
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	116.99
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	91.36
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	90.74
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	86.57
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	83.06
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	77.92
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	77.58
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	77.08
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	76.13
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	75.50
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	71.89
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	71.21
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	70.00
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	69.67
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	69.32
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	69.00
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	64.06
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	63.13
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	62.07
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	61.13
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	61.02
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	57.61
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	55.73
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	53.58
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	52.68
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	52.28
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	51.78
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	50.47
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	49.62
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	46.61
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	45.12
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	40.24
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.23
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.95
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.56
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.62
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.