Gene detail

Detailed information of XP_074635683.1 in Acropora palmata

Genomic Location: NC_133891.1:9192685...9206397
NR annotation: XP_029191963.2, TRAF-type zinc finger domain-containing protein 1-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074635683.1

ATGGAAGAAGCAGCTGAGACCAATTATTGTTCAAACTGTCGCAGAGACATTCCGGCAGGAAACTTTGTCATGCATGTCACTCACTGTCAAAGGAATTTGACTTTATGTAAGACTTGTGGTGAGCCTGTACCAACATCACTGCAAGAGGAACATTTTGAAGAATACCATGCTAAGGTGAAATGTGAGTGTGGCGAGGAATTAGAGAAAATGAACCTTGAGGAACACAAGGAAAACACTTGTCCAAACCGTATTTTAGATTGTCAGTTCTGTGAACTTCAGCTTCCGTTCTGTAAATTAAGCTCTCATGTGGAGTACTGTGGCAGCAGAACCGAGAAGTGCGATACTTGCGACAGATTTATCCAAAAGAAGGACGTAGAAAAACACATAGAGACAGGATGCCAATATCCTGTGAGAGAAGAAAGCAAGAAAACACCGCCAGAGACACCTGAGGAATCTTACTTGGACTTGCAAGGTGATCTGCTGCGTGCCATGGGATCAGCTGAGAGTCCTGATGAGGGCTTTCCTGGACTTGCCAAGTATCTCCCCTCTGCCATGACAGGTTGGCATGTATTTCAACAGATTTTGGACACTGGACTTGGTGTCCCTCCTCTGAGTGGAACAAGTTACTTTGATGATGCCACTTATGGTGCATTTAATGGCAGCGATGTTGTTGCGAGAGGTGCAAAACCAAAGCCTCTGAAATCCATGTTTAATCATCGTGGTATGGAAGATTTTGAAAGGGATGAAGAAAGAGATGATGATGAAATGCTGGCAGCCGCGTATAATGCTGATGTGTATGATGATGATTATGGTTTCAATGAGATGCCATCAGGAATAATTGACGTATCTGATGCGGGTTCACCAGATGAAACAGAACTTCCCTGTGAATTCTGTGGAGAGCTGTTACCAATGGATTCCCTCATACTTCATCAGAGCGGTTGTCAGTTTAGATCAATGGATTCATTCTCGGGTATTGCCTCTAATGGGCATCATCACATTGACAGCCGCGAGCGTAGTGTGACACACGTAAATAACTCAGCAATTTCAAGGCACCGAGAAATTGACGATTATGAAACAGAACAACAATACTCGGATGAAGATGAAGGAAGATCAGATGATTCGACATTTTTGCCGTGTGAATTCTGCCAGGAACTGTTTCCTTTTGATAGTCTCATAGCGCACCAGGCCGTCTGTGACGTGGACGACCAGGCCAGACTTCCTCTTGCAGACATGCGCAATGGCGCAGAATTTAAGCCCCTGAACAACACCCAGCCACAAGTTCGAAGTGGACCAACGGGGCGGCCAAGCAGGCCGGTGTATGGATCAAGAACGAACGTGCAACCCGCGGAAGACTTTATCCCAAGCGAACTGGACGATTCCGGCTCAGATTTGGACTTCTCACCGAAGGATACTTGGGTACATCTCAGTCGAGTCGATGAGTCGCTGAGTACTGTGCTGAACAATGAGTCAAGTCGAGCCACAGGGGGGACAACACGCGAAGATGTCCCTCGTCGGCCAGCGATGGTACGAAATAACGACACCGTTAACAGGCAACCCAGAGCCAGTTTCAAAAACAGGGAACCCAAACCGTGGATTCCTCAAGCGAAACCGAGGGATACAGTTGCTGCACGTTTTAGCAAGACTTCAAAACCAGGAGATGAGGAAATGGGTCGAAGGAAGATTAGCCAAGCAGCATTAAGTATACCGGCGGGCTCTCCGGCCAATTCCAGTCGTCCGTCTCCGAAAAACAACAGCAGAGTTGACTTGCGACGCCAAATTTCAAGCAACGGTCATTTCAGTGACTACGTGAAGAGTTATTCAGATTCTAGCCTAGCCGTGGAAATTCCTAGGAAATCGGGAGCGCCTTCGAACAAGGCACAACGAAGCAACAATGGAAATCCGAGCATGAAGTCATTTCTTGGAGCTCCGGCCTTGCAAAGTAGCAAATCCAAACCAAGGAAGGAATTACCACCCATCCGTTCTTCTGGCAACTCCTCTACCAATCCGTCTTTTCCGAATCCTCGCCGAAATCTTCAGACAAAGATTTTGGAACCAGCTCGTTCCAACGGAGGACGGCCGCGAACTCTTAACGTGAGGGGATCATCTTCGGATTTTCAGTCAAGCAGTGCACGGACTGTGGCTCCTACAAAAAAATCAACAACTAGAAAGAAAATAGCATGA

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002957 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF21366 all species →	TRAFD1-XIAF1_ZnF	TRAFD1/XAF1, zinc finger	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR049439 all species →	Domain	TRAFD1/XAF1, zinc finger	Interproscan
IPR013083 all species →	Homologous_superfamily	Zinc finger, RING/FYVE/PHD-type	Interproscan
IPR051986 all species →	Family	Innate Immunity and Apoptosis Regulator	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR16295 all species →	TRAF-TYPE ZINC FINGER PROTEIN-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005739 all species →	Cellular Component	mitochondrion	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for XP_074635683.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074635683.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

74TPM > 0

2Conditions

70.6Max TPM

23.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	40	20.20	53.85
all_coral_tissue · baseline	38	34	28.47	70.62

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	53.85
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	53.33
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	38.72
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	36.35
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.45
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.82
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.15
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.99
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.57
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.30
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.24
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.81
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.81
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.83
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.44
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.17
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.55
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.22
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.75
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.49
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.47
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.34
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.70
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.15
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.46
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.16
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.86
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.13
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.77
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.26
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.80
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.27
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.49
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.36
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.07
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.98
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.88
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.40
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.08
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.85
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	70.62
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	50.04
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	49.29
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	42.76
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	42.31
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	41.87
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	41.87
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	40.56
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	39.76
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	39.72
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	37.98
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.98
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.23
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.35
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.26
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.41
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.22
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.84
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.56
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	31.45
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.85
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.81
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.47
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.40
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.21
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.04
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.12
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.94
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.07
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.98
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.98
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.51
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.93
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.43
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.