Gene detail

Detailed information of XP_074635756.1 in Acropora palmata

Genomic Location: NC_133891.1:4790461...4801767
NR annotation: XP_029194407.2, BCAS3 microtubule associated cell migration factor-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074635756.1

ATGCCCAACATAAAACAGACCATCGACAATCAAAACAAACAAAAGCTTAGACTGTTCAACAACAACACAACCGAGAATGAGGAGTGCAAGCTGTGTAATTGCAAGAAAAAGGATGAATGTCCCCTTGATGGAAACTGCTTACAGGCCGCTGTGATCTATCAAGCCAAAGTCACACAAACGGACAACAACACTCATGAAACTTATGTTGGATTAACAGAAAATGATTTTAAAACGCGCTATAGAAGTCACACCGCATCATTCAGAAATATAGCATCTAGAAACTCAACGGAACTCAGTAAATACGTCTGGTCATTGAAGGACAATAACATCGATCACGGTATTATTAATTTTCTATTTTCTTATCTTTGCAGTCCATCAGTGCCTTTTTCTACTGTCAATTTGTGGTCTCTAGCTTCTGGAGAGCAAGTTCATTCTATTGCATTTAAGTCTGAAGTTTATGATGTACTGAGCAACCAAAGGTTGATAGTTGTGGCTCTTCAAGAGAAAATTGCAGCTTTTGATGCCTGCACATTTAAGAATTGTTTTTGCATTACAAGCTGTTACCCTGCACCAAGCCCAAACCTCAACCCATTAGCTTTGGGCAGTAGATGGCTGGCATATGCAGATTGCAAGCTAGTACCCAACCACCAGTCTTGTGGTGGAGTATGTGGGGATAATTCTCAGTCATATACTGCGACAGTTATCAATGCTGCCAAGACTCTTTCCAGAGGCCTTACAATCTTTGGAGAGACAGTGGGCAGGTGGACAGGAACAGAAGGTGCAAGTGATTATGGCAATCATAAAAAGTGTGTTATCAGACCAGGGGTTGTCACAATCATTGACACAATGAAAATTGGCAATGGAGAGTTCTGTGTGCAGGAGGATGACCATGAAGGCGCGGGTATAGCGGCTCATTTTCCAGCTCATGCCGGGCAGCCCCTGTCATGCATGTCTTTTGACCCCAGTGGTTCCTTATTGCTGACTGCAGACACTCTTGGGCATGATTTCCACTTGTTTCATGTCCTTCCTCATCCTATTTGTCCATCGCTCAGCGCCATTCATCATCTTTACACTCTTCACCGAGGCGATACAACTGCCACTGTGCACGGTATTGCGTTTTCTTTGGACAGTCGATGGGTGTCTGTATCTACTGTCCGTGGAACAGTGCACGTGTTTCCCATCACACCGTACGGAGGTCCAATAACAGTTCGCACCCACTCCTCTCGTCGTGTGGTCAACCGAAGCAGTCGGTTCCACACAAGTGCTGGATTGGACGACCTGGATCAGTCATCCACACCCACAGGCCGGCACAGTCCATGCAATGGCACAGGACAGTCACTTTCATGCTCACCGAACGGAAGCCCTCTCAGCTCCACAACGACTCCAGTGACAAGAGACTCTGTGGCGGTTGCTTGCAGTAATAATGGTTTGGTAAACCCTCGGTTGCCTCCACTTCCACATTCCTATGTAGTATCCCCCCTTGCGCAAATTAGAACACCCGCTGGTCCTCGTTGCGGTGGGCTTTGTTGCACGGGCTCGACCCAGCATTCAAACAAATGCAATGGCCGAATAGGACTAGAGTACTCAATGGGCGTGGCTATGAAGTTTGCACCCTCCCGAGGATGGTTGGGAGGAAGTCCAAATATGGCTAGGGCAGAACCGAACAAGTCTTCAGCTTTCGATTCACTCTTCATCCTGGATCTCCATGGAAACTTGACAGAGTATGTGTTGGAACCAAAAGGCGTGAAGACCGTACCCCAGAGCGATGACACGCCGTTGGAGCTTATCACCACATCGCGGGCGCACTGGGCACTCACTAGGTACCCCGCATGGCCAGAAAGTAAGAATCCAGTCGTCAAGGACTTATCCTTGTTGCTAGGGAGATCCAAAGGTCCATCAAGTGATCTCAATGCACTGACAGATAAACAAGGAAAGAAAGCTGTAACAGAAAATGACGCTCACTTCGCATTCACACGTAAAGAGGAAGCGAACTTCGACGGTTGCTCTGTTGATGACCAGTGGCTTGCAAACATAGACATGGAGACACATGCTGCTCCACATAGGCGCCTCTGGATGGGACCTCAGTTCTCCTTTAAGACCTACCAACCACCCGGGTCATCATCAGCTTCTTCGACTCACAGCTTAGGGGACTCGAGGTCCGGGGGGTCAGGAAGTGGGGCCACCATTGCGGCCCACAACAGGGATTTCCATTCCATGGACCTGTACTCTGAAGAGCTCGATTTGCAGAGCTTACGTTTGCAACCAGTGCTCTCTGATCCAGTTCCTACACCGTCAGGTCGTTATGCGTTTACTGGGTGCGCATCGCCCAATCTTGGCGGAAGTATGCCACTAATCGTTGACAACGGCCCGGGTAGTTTGATAGAACCTTGGCCTGGTGCAAGCAACGATATGTGTGAAGACAAAGAGGAACAGTTGGTTGAAACTCTGGCAGACGCCATGAACGACAACGCGACGCTGCCTGTAAAAATCGGCAAGAAGGGAACGACGACAATCAACGGGGAGAATCAGTTCCAGTTTCAGTCCGACAATCTTGGGGGTGGGGTGAATGCGTTTGCCTCGCATTCCCCCACTGAAACAAGTCCCTTGTTCCCACCCGATTGGTCTTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8CCN5	BCAS3 microtubule associated cell migration factor OS=Mus musculus OX=10090 GN=Bcas3 PE=1 SV=2
Q9H6U6	BCAS3 microtubule associated cell migration factor OS=Homo sapiens OX=9606 GN=BCAS3 PE=1 SV=3
Q8SY41	Breast carcinoma-amplified sequence 3 homolog OS=Drosophila melanogaster OX=7227 GN=rudhira PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0008907 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF21034 all species →	BCAS3_WD40	BCAS3, WD40 repeat	Repeat	Interproscan
PF12490 all species →	BCAS3	BCAS3 microtubule associated cell migration factor, C-terminal	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR045142 all species →	Family	BCAS3-like	Interproscan
IPR048382 all species →	Domain	BCAS3, WD40 domain	Interproscan
IPR022175 all species →	Domain	BCAS3 domain	Interproscan
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR13268 all species →	BREAST CARCINOMA AMPLIFIED SEQUENCE 3	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0006914 all species →	Biological Process	autophagy	Interproscan
GO:0042594 all species →	Biological Process	response to starvation	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for XP_074635756.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074635756.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

66TPM > 0

2Conditions

35.5Max TPM

15.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	33	13.20	28.49
all_coral_tissue · baseline	38	33	18.22	35.47

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	28.49
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.16
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	27.07
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.92
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.00
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.81
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.68
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.99
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.68
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.61
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.31
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.44
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.09
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.04
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.65
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.23
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.67
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.33
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.25
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.32
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.77
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.07
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.24
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.49
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.26
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.60
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.92
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.23
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.83
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.35
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.34
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.03
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.29
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.47
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.52
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	29.37
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.73
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.61
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.54
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.00
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.89
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.23
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.37
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.81
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.39
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.24
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.42
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.31
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.28
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.24
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.15
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.85
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.66
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.34
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.06
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.41
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.74
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.32
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.86
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.51
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.31
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.10
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.64
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.61
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.24
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.31
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.