Gene detail

Detailed information of XP_074636231.1 in Acropora palmata

Genomic Location: NC_133891.1:8908388...8939312
NR annotation: XP_044173925.1, trafficking protein particle complex subunit 11-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074636231.1

ATGGCGGCCGCGAGTGAATTTCCCAATGAACTTGCTACTCGTCCCCTTGGTCTTGTAGCTCTTATGGGGCTGAGCATAACACAAAAACCTTTACACAAAGCCATATGGGAGTCGTTTTCTGTGAACAGGCACCCGGACAGAGTGCCTTTGTCTTTTAGACTTCTTCCAATTGACCACGAGTTCCCTAAAGCCAAATCAAAGAGGTCAACATATGAATGGTACATACCAAAGGGAGTCTTGAAGACAAAATGGATGCATAAGCATTTATACCTGACCCCAGCTGTGGTAGTCATGTTTTATGAACTTGATTGGGATGATGCCCAGTGGAAAGAGAAGCAAACTGAATGTGCATCAAAGCTTCAAAGCATCAGGAGCGGTCTGCAAGATCAAAACACAAAGGTGGCTGTTGTGCTGATTCAGAAGAATGCCCCCTTACCACCTGGGGATGATCTTCAAGCCCTGGAAAGAGCCGCTACTCTCTGTAGTGCATGTGATCTTTCTGCCAAATCTTTGTTTGTTCTTCCACATACGGATCACTTAATTGGTTATACGATCAGACTAGAAAATGCTTTTTATGATCTGAGCCAAAGCTATTACCATGGTGAATGCAGAAGAGTCAAGGCCCACAAAGAATTTCTCAATAAAGGAACTCATCAGTTTCTGTTGGTACGACATCAGTTTAAAGTTGCATTCTTCAATGAATTGCGACAGGACCCTCACTCTGCCATCAAGCATTATCGCCAAGCTTACAATCTTCTTGGGGAAATCAAAACAACTGATATTAACATTTTAGAAATAAAAGTTGTTGCTGGATTTATTAGTTACAAGATTTGTCGCTTGAGTTTCCAAGCATCAGCTCCTTTAGATGCGATATCACAGTTTAGGAAACATGTTGATCTATTCAAGGAGAAAGTTGGCTGTCCAGAGCTTGCATTTGAACACTCAGCTTGGCTTTCCAAACAGTTCAGTTTATTTGGTGAGTTGTTTGATGAAGCCATCAGGAATGGGCTGACAGCCCTTCAGACTCAACACCCAGGGTTTTATTACCAACAAGCTGCTAACAATGCCATTGTTAGGAGACAGTTGTGTCAGGGTTTGTGCCATACCACCACTCCATTGTCCATGAATCCTTTAGATAATGCTGGCAACTTGGATTTCTTTGGCCAAAGACCTTGGAGGCAAGGGTTTCAAGGAACTGAGCCACCAGATGCCGCATTAGAGCATGCAGGAATAATAGCACTGCAGTCTCAGGAACTGCAAGTAGACCATTCATGGATCATTATTCCCCTTCTAAGTAGTGCTGTGGCTCAGTTTAAAAAGTACAAGTCCCCAAGAATGAAAAGATATCTCATGGTGCAGATGGGTGAGGAATACTACCATGCAAGAGATTTTAGCAAAGCTCTGATGTTGTTGAGCAGAGTCAAATGGGATTATTGCAGAGAAAAATGGTGGTCGCTTCTGACATCAGTGTTAATCACATCTCTTAGGTGCGCTTACTTGGTTGGAAATATCCAAGAGTACATTGGCCTTTCGCTGGAGTTGATGGGCAGATATGCTGAAAATTCACCTGAGGAGAAGACAAGATGTCAGACGAACCTTATTCAAGTCATGGCGAATGAGTGTCCAGAGCCTGAGCCTGGCTGTGATTTTGAAGCAGTTGAAGAAGCAAAAGAACAGTGGAAAACGCTGAAAGCAACACCTGAGGCACCCCAGGTGTTTACCATACAGATGGAGCAGATTGCCCCTTTTGTTGAATGCAAGGCAGTTTTTGACTCTTCTACTATCACTGCAGATTCTACCATCCTCCTTCAAATTTACTTGAGAGTCACTTGCACGTTTCCCATCCGGTTTTCCAAGATTTCTGTTTTCCTGAGTAATCAGTTCTACAACCAGCATTGTGTAGTGGAAACGTCGTCCGCTCAAAGCGAGGGTGGGCTCTATCTGTCGCCAGGCCAAACTAAAGTGATTCCCTTCCAGCTTGTCCCGCAACCCGAAGATGTTGGAAAACAGCTGCAGGTTACCTCCATTGCTCTTGAGCTGGGTTCCCTCGAGTCTCGTTGTGCCGTGCTTGTGTGGAACGGTGGGGGAGTGGAGGCCTCAGCATCTTCTAACAAATCTTTTGTATCATACGGCTCGAAATCTGCCGCGAAAGAGGACCAGTTTGATTGGGATGACTTACAGATTGTTTCCAAAATCAAGATTGAACCTCGGAAGTCTAGTATAAACGTTGAACTGAAGTACGAGCCACCGGCACTAGTGAATGAGTTTTACGAGCTGCAGTTGGCTGTTGAGAGCTTAGAAGACACGACCGTGAAAGAAGTAAGGGTTTGGTTGGGATTCCATGATGAGCAGGAGCCTACAGACAATACTGCCTTGATTTGTTGTGAGGTTCCAACTGCTGAGCAGCCTCAAGGACAAACCCCTAGCTTCACTGAATTTAGAGTCGAGGAATTCGACGGAAAGATGGAGAAATCGTTCTTTCTTAAATGTTCGCAAGTTGGTTCGCGGACAGTCATCGCTAAGATTGTGTATTCTGTGGATGTTGAGGTCAAGCCCAGTAAGAAATCTGTGACATGCACTTGCGTGAAGGAGCAGAGTATATCAATTAAGACCGTCATGCCCTTTGAAGTCTCCCTTTCATTGACAAACCTCAAGCTTGAGAGACTAGACCAGGTGTTTGAAGAAGAGCCGTTTCTCTTATTGGCTGGTATCAAATGCACGTCTCCCTGGCCTGTCACAATGGTGAACACCATTTTAAATATGTCTCCTGAAGTGAATTTCGTTGGCGAAGCGATGAGTTCCCAGCTTCAAGGAGTTTCCCTTCAGCAGGGTGAGAGTGCTTCGGAATGCTACTGTTTGGAGGTCAAACCGGACGTTAGTAAGCTGAAAGTGGTTAACATTGGCAGCTTGTCTTTACAGTGGAGAAGAACTTCTGCTTTGGAATCGTTCCCAGTTGTGGTGACAGAGCTAACTTTTCCCTCCGTAACGGTTGAAAGTGTCCCTTTTACCATTCAGACAGATTTACCAGCGTATGGCTGCGTACAAATGCCGTTGAATGTCAGTTATCTTGTGCGCAATCGCACTTTTCAAGTTCAAGAGGTTGAGGTCAACGTGGAACCGAGCGATGCTTTTATGTACTCGGGACATAAACAGATTCAATTTCGTCTGCTGCCCTCTGGGGATCACAGGCTCAAGTTCAGTCTGTATCCTCTATCCGCCGGTTTCTTGACGCTTCCAAAGTTACACTTCAATCTGCCTCGCTTCCAGGTTAGCTGGGACGAGCAAGCGCAAAAGATGATTCCTTCCAACGTTTTTATCAAGCCAAAGGGACACGACTTGAGTTTGTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5ZI89	Trafficking protein particle complex subunit 11 OS=Gallus gallus OX=9031 GN=TRAPPC11 PE=2 SV=1
Q7Z392	Trafficking protein particle complex subunit 11 OS=Homo sapiens OX=9606 GN=TRAPPC11 PE=1 SV=2
Q1RLX4	Trafficking protein particle complex subunit 11 OS=Danio rerio OX=7955 GN=trappc11 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003086 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF11817 all species →	Foie-gras_1	Foie gras liver health family 1	Repeat	Interproscan
PF12742 all species →	Gryzun-like	Gryzun, putative Golgi trafficking	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR021773 all species →	Domain	Trafficking protein particle complex subunit 11	Interproscan
IPR025876 all species →	Domain	Trafficking protein particle complex subunit 11, C-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR14374 all species →	FOIE GRAS	Interproscan

Gene Ontology

No Gene Ontology signature was detected for XP_074636231.1. This gene does have a gene model — the search simply returned no hit.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K20308	TRAPPC11; trafficking protein particle complex subunit 11	-	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074636231.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

71TPM > 0

2Conditions

27.0Max TPM

17.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	38	15.96	26.52
all_coral_tissue · baseline	38	33	18.70	27.01

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.52
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.10
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.94
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.38
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.71
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.55
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.54
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.47
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.18
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	22.06
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.88
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.40
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.02
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.76
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.48
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.32
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.31
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.72
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.67
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.65
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.56
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.98
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.18
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.15
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.15
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.85
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.78
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.47
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.09
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.50
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.47
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	16.29
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.50
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.48
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.11
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.89
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.54
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.56
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.01
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.88
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.48
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.23
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.13
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.52
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.39
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.97
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.79
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.53
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.50
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.28
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.22
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.20
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.64
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.95
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.77
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.48
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.40
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.28
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.20
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.02
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.69
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.63
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.39
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.23
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.05
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.58
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.23
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.93
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.02
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.61
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.30
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.