Gene detail

Detailed information of XP_074636809.1 in Acropora palmata

Genomic Location: NC_133891.1:7376623...7397307
NR annotation: XP_029202966.2, nitric oxide synthase, brain-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074636809.1

ATGTGCTCAAAAGTCCAATCGGAATTCCCCTCAAGTGGTTCTTTTGGAGAATTCCAGATAAGACCACAGGAACCCAAATATCTCAGATTAAAGAACTATGTGGAAGGTTCCGAGGTAGTTGATACTCTCCATCAAAAGACGAAAATACCTCTTCATTGTACCAATGGGCGCTGCACTGGCTCCATTATGATCCCGCGTGGAGGCGAAACACCCCAACCACGGTCCTACGGAACACCGAGGGATAAAGAGGAGGTGACAATACACGCTGAAGACTTTCTGAAGCAATACTTTGCTTCTATTGCCAGGTCCAACAGCGATGAGTATCACGAAAGACTGGCCGAGGTGATGATGTACATTGAAGAAAACGGATCATACAGCTTGTTGGAAAAGGAGCTTCTCTTTGCTGCCAAAACAGCGTGGAGAAACGCTTCAAGATGCATTGGGAGAATACAGTGGAACAACTTGAAGGTGTTTGACGCTCGCGATGCAAGGACTGCGAAAGAGATGTTCGATGCGCTGATGAGGCATTTGGAGTTCTCTCTTAACAAGGGCAACTTAAGATCAGCAGCCACCATTTTTCCTCAAAGGAGTGAAGCAAATAAGGATTTCCGTATATGGAATTCCCAACTGCTCGGCTTTGCTGGCTATCGGCAACCCAACGGTGCTGTGATCGGTGATCCAGCTAACGTGGAATTCACCGAGATGTGTCAGTCGCTGGGTTGGAAAGGAAATGGCGGTAGATTTGATATCCTGCCCCTGGTGTTACAAGCCCTTGGAGGAAGCCCCGAGTTCTTTGACATACCCAATGATCATGTTTTTCGTGTGAAACTAAAACATCCGAAATACCCTTGGTTTGAGAAACTGGGTTTAGAGTGGTACGCTATTCCTGCTGTGTCCAACATGATGCTGGATGCTGGAGGTCTGGAATTCACAGGCACAGCATTCAGTGGTTGGTATATGGTGACAGAAATCGGAGCAAGAGATTTGGCAGATGAGCAACGCTACAACATGTTGGAGGTTGTTGCCAAGAAAATGGGCTTGGATACCACAAGTAACGCGTCCTTGTGGAAAGATTTTGCATTGGTGGAACTCAATTATGCTGTTATGTCCAGTTTCACGGAGGCTGGAATCACACTTGCTGACCATCACACTACATCAGAGGCCTTCATACAACACATAAAAAAAGAGGTGAAGCTGCGAGGTGGCTGTCCAGCGGATTGGGTGTGGATTGTTCCTCCAATGTCAGGCAGTGCAACAGGGGTGTTCCATCAGGAAATGCTGAATTATGTTTTGAAACCAAGTTATGAATATCAGCCCAATCCTTGGACAGTTTACAGCGTTCATGGAGAGACCAAGAAGAAAATGTCCTTTAAATCAGTGGCCAGAGCTGTTCGTTTTGTTGCTTTCTTGATGAGAAATGTTTTGTCGAAACGGACAAAAGCCACAATCTTGTTCGCAACAGAAACAGGGAGGTCAGAGAGATTCGCTTGGAATTTAGCCAAGGTGCTGTCGCACATCTTTGATGTTAAGGTTCGTTTTATGGATGAATACGAATACAGGCGGCTTGTTCATGAGAAACTGCTGTTTGTTGTTACAAGCACATTTGGTAACGGAGAATCCCCAGAAAATGGAGCGAGCTTTGCTGCCTTCTTAAAAGGCTTGAAGAATGAGACTACAAGACCTTTGAAAAACCTCAGATATTCAGTTTTTGGACTGGGATCCAGGGCTTATCCTGATTTTTGCGCCTTTGGACACTACGTGGATGATCACTTGAGGGAGCTTGGAGCCCAGACAATTCTAACCATGGGGGAGGGGGATCATTTGGCCGGCCAGGAGGAGTCATTTAAGGAGTGGACAAAGGATGTGTTCAAGATGGCGGCTAATTGCTTTGGAGTTAACACTGAATCTGCAAGCAAAGTGGTCAGTGACTCGTTAAAAGAGATGGTCTCAGGCTGGAGTCCAGGCCTTTACCGTTGGGTGAGCGACAATACAATACCAATGGACCTTTGTACAAATCTTTCCAAGGCTTACAACAAGACTGTATGCTCAGCAAAAGTCATTTCAGTGACTGAACTTCAGACAAAGCGTTCAAGGCGCTCGACTGTTCTGGTTAAGCTAAACACAGGAAACGCAGCACAGCAACTGGCCTTTGAACCAGGAGATCACGTGGCTATTTTTCCCGCTAACAAGGCAAGTTTGGTGCAGGAGCTGATCGACCTTATGCACGAAAAACCTGATCCGAACCAACCAATCAGGATTGAGGTTGCCCACGAAGATTCAGGAAAACAAAATGGAACAATGACGTGGAAGCCATTCAATCGACTTCCCGCTGGCTGCACATTGACAGAGGCACTGACGAGATACCTGGATATCACAGCTGTTCCAACACCGCAGATGCTCAAGTATTTAGCAAAGCTGGCAACAAGTACACTGGAAAAGATGCAGCTTGAGGCCCTTGGAAAGGGTTACTCTTGTTACGAGGAATGGGCCCTACTAAAGGAATGCAACATCCTCGAGACACTGCGAGAGTTTCCGTCTGTTAAAGCTACCGCAGACCTGCTTCTCACACAACTTCCGGCTCTGCAACCGAGATTCTACTCAATTTCCTCTTCCCCTGACGTGTACCCCAAAGAAATTCATGTAACAGCGATGGTGTTTGAATACAAAAAGAGAGGTGGCAAAGGTCCAATGCACGAGGGTGTCTGCTCCAAGTGGCTTCAGTCATTGAAATCTGGCCAAGCTGTTCCTTGTTACATCAGACAAGCCCAGGCCTTTCATCTTCCATCCGATGGCTCCGCACCATTGATTCTTGTAGGGACTGGAACAGGTATCGCCCCTCTGCGCTCCTTCTGGCAACAAAGGGTGAGTGATATGAACAAAAAATCTCCGCCGAAGTCAGCAATAACGGGACGGAGACAGTGGGGAGACATCCGCTTGTTCTTCGGTTGTCGTAACCCGTTTCTCGATGACATTTATCGCAATGAAATCGAAGAAGCAGTGCGAAGCAAAGTTCTTCGTTCCGTGGCTACAGCGTATTCCAGAGAGAAAGGAAAACCGAAGCAATATGTTCAGGATCTCTTGAGGAAGGACTCCGCTGACCTCTGTGACTTAATACTGAACAGACATGCGCATGTGTATGTCTGTGGAGCCGCTGACATGGCTAAAGGTGTTTATCAAACCATTCAGGCTATTATTGCCGATCATCAAAATTTCTCACCTGAAGAAGCTCTGGAGTTTATCCGCAAAATGAAGTCATCAAGCCAATACCACGAAGACATCTTTGAAGTCCCTCGAAAGATCAAGGAACCAAAGGAACGTGGATGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9Z0J4	Nitric oxide synthase 1 OS=Mus musculus OX=10090 GN=Nos1 PE=1 SV=1
P29476	Nitric oxide synthase 1 OS=Rattus norvegicus OX=10116 GN=Nos1 PE=1 SV=1
P29475	Nitric oxide synthase 1 OS=Homo sapiens OX=9606 GN=NOS1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001036 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00175 all species →	NAD_binding_1	Oxidoreductase NAD-binding domain	Domain	Interproscan
PF02898 all species →	NO_synthase	Nitric oxide synthase, oxygenase domain	Domain	Interproscan
PF00258 all species →	Flavodoxin_1	Flavodoxin	Domain	Interproscan
PF00667 all species →	FAD_binding_1	FAD binding domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001433 all species →	Domain	Oxidoreductase FAD/NAD(P)-binding	Interproscan
IPR008254 all species →	Domain	Flavodoxin/nitric oxide synthase	Interproscan
IPR001709 all species →	Domain	Flavoprotein pyridine nucleotide cytochrome reductase	Interproscan
IPR012144 all species →	Family	Nitric-oxide synthase, eukaryote	Interproscan
IPR004030 all species →	Domain	Nitric oxide synthase, N-terminal	Interproscan
IPR017927 all species →	Domain	FAD-binding domain, ferredoxin reductase-type	Interproscan
IPR044943 all species →	Homologous_superfamily	Nitric oxide synthase, domain 1 superfamily	Interproscan
IPR029039 all species →	Homologous_superfamily	Flavoprotein-like superfamily	Interproscan
IPR044940 all species →	Homologous_superfamily	Nitric oxide synthase, domain 2 superfamily	Interproscan
IPR050607 all species →	Family	Nitric Oxide Synthase (NOS)	Interproscan
IPR044944 all species →	Homologous_superfamily	Nitric oxide synthase, domain 3 superfamily	Interproscan
IPR017938 all species →	Homologous_superfamily	Riboflavin synthase-like beta-barrel	Interproscan
IPR039261 all species →	Homologous_superfamily	Ferredoxin-NADP reductase (FNR), nucleotide-binding domain	Interproscan
IPR001094 all species →	Domain	Flavodoxin-like	Interproscan
IPR023173 all species →	Homologous_superfamily	NADPH-cytochrome p450 reductase, FAD-binding, alpha-helical domain superfamily	Interproscan
IPR036119 all species →	Homologous_superfamily	Nitric oxide synthase, N-terminal domain superfamily	Interproscan
IPR003097 all species →	Domain	Sulfite reductase [NADPH] flavoprotein alpha-component-like, FAD-binding	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR43410 all species →	NITRIC OXIDE SYNTHASE OXYGENASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016491 all species →	Molecular Function	oxidoreductase activity	Interproscan
GO:0010181 all species →	Molecular Function	FMN binding	Interproscan
GO:0004517 all species →	Molecular Function	nitric-oxide synthase activity	Interproscan
GO:0005516 all species →	Molecular Function	calmodulin binding	Interproscan
GO:0006809 all species →	Biological Process	nitric oxide biosynthetic process	Interproscan
GO:0020037 all species →	Molecular Function	heme binding	Interproscan
GO:0050660 all species →	Molecular Function	flavin adenine dinucleotide binding	Interproscan
GO:0050661 all species →	Molecular Function	NADP binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for XP_074636809.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074636809.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

3TPM > 0

2Conditions

34.9Max TPM

0.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	2	0.05	1.16
all_coral_tissue · baseline	38	1	0.92	34.91

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.16
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.12
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.91
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.