Gene detail

Detailed information of XP_074636892.1 in Acropora palmata

Genomic Location: NC_133882.1:19916981...19935092
NR annotation: XP_015751432.1, PREDICTED: poly [ADP-ribose] polymerase 12-like isoform X2 [Acropora digitifera]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074636892.1

ATGGCGGATGATGTTTTGGCGAAGAAGTTCAAAGGAAAACAGGAACAGAGCTTCTCCGCATCCAGCGCTTGTTCAGTGCAAGGCCCAAAAATTAAAAATGCACCCAACACAAAAGAAGTATTTGATTGCATTTTAAAGAAATATAATGGCTCGGTGTCCGTTGACACCATTTCTAAACGACTTGATTTATTTCCGGTTGGATGTGGAGACGTCTTAAAGTGGTTCAAAGAGAGGGAAGAACATTTTTTGCTCAGACAAGAGAACGAAAAAGTGTTTGAGGTAAGCGTTTTCATCAACAAGGTGCGCTTGTGTGTTGATCCGACATGTTCCAAGAAGGACTGCAAATGCTTCCATGTTTGCCGTGATTTCATAGCAGGTTTCTGTAGATTTGAAGCTGACTGTAAAAGGAATCACAGCTTTCAATACGACAAAGATCGCAATTTTATTTCAAAACTGAAGTTAGGGGGTCTCACAGAAGAAGAGCTCTCTAAGCTTTTACAGCTCTCGATGCCACAGGTCTGTTTAAAATACAACAATGCGGCCTGTATTAGCCAAAACTGTGGAAGGGTTCACATTTGCAAGTCTTTCGTCAGGAGAGCCTGCCAAGGTGGAAATTGTGACCTCGGGCTCTTCCATGAAGACACTTTCATGGAAGCTAACACGGCTGCAACACTTAAGAGGTATGACTTGAGATTCACAGGAAGAAACACCAACTCTATCCTGAATTCGCTTCTAATTTGTGACAAAAACACAAGTGAGAAACAAGGCAAGAAACGGGTTTTTGCGAGTTACGAGCCCTCCGAAATGAAAGTTTTCGAATGCCTTTGCAAAGAATTCCAGTGCTCCGCTTCCTTTTCCCTGATTTCCAAAAGGACTGATTTATTTCCTAAAGAGTTTAATGACGTTGAGGCGTGGTTTAGAAGAAGGAAAGGCAGCTTTTTTATCACCGAAAGCGACAATGGGACGATTTTGAAAGTGGATGCTTATTCTGTGAAGGCAAGATTGTGTTTGAGTTACAACAGCTCGCACTTTGGCGATTGCCAAAAGCAGCACTGCTCATATTTGCATGTCTGCAAGGGGTATATCACGGACTCATGCAGTTATGGAGCGACATGCCCAAAGGATCATCATTTTCAAAATGAAAGGAACAAACAGTTGCTTTTAAGGGTTAAACTGGAAAAGTTAACAGACGACGAATTGCGCAAGCTTGTGATGTCTTCAACACCTCAAGTGTGTACTGAATACAACAACAGTGGCTCCTGTGATGCAGGCTACGCGTGCAACAGAATACACATATGCAGCAATCATTTAAGGAAGGTTTGCAGTGAAGGCGATAACTGTGCCTTACAACATGATTCAGCATTGCATACTCCTCGCACAGAAGCAATCCTGCAACGTTATAAGCTGAACGAATTAAAGCGTGACCTAATCAAGAGGATTGTGTTGGTTAAATGCGACAAGTTGACAAAAACCGAGGAAACAGGCCACATTCATGGCGACAACCCAGACGCACCCATTTGCAAAGATTTTCTTCTTGGCAACTGTAAGAAGGGCTCCAAGTGCCATGGCCACCACTGCACTTTACCTTTTCAGTGGCAGTACAACAGTTATGGAGAATGGATTACCTTTAATGATGGAGACAACGAAAAGTTTGAGAAACTCTTCTGCGATGTGAATGTAGATGAAACCCAAGTCAGCCAAATTTCGGTTGCTTTATCCAACGAACACTCGGATCGTCTCCTCGAGAGCTGTGATGGCACTGTTCTACTCGATGACAAAATTTTGATTATGGGGAACTCGTTTGCAACCGTTGTAACTCTAAGGCGTCTATCCACTGTGTCTTATGTGCATGACCCTGATGACACCACTGCCACTCTGTGGACCTGGTACTGGGTGGACGAGCATGGCTACTGGAGAGAGTACGACCTCAACCACACGGGTACGGATCTTCAGCAAGCCTTAGAAGACGCCTTTTTGCGGAAAAGTCCAGGGGGATTCCACTTTCGGATTGCGGATCAAGATTACAAGATGAACTTCTCCCCAGAATCAGATATGAGCCAAGAAAATGTGAGATACGGCACCAAAAGAAAAGTGCGAAGACGACCAAGCGAATTTGTTACCGGAAATGACATCAAACTGCTGAAAAGGCCCGAAGGTATGCTCTCTGCACAACAGACGAAGGCAAAGGATAGTCATTTGCCGTCAAAGTGGTCGTCAATGCCATCTGAGACCCAATACAAGCGCGTTTCTTTGTCCTGTTTGTCGCCAGAATTTAAAGATGTAGAGAAGCTTTTCAAGGAGTCAATGAAACGCAGTGTGAAAATTTTAAAGATTGAACGAGTTCAAAACCCTTTCATGTGGGAGAAGTATCAAAGGAAGAAAGAAAACATGTTAGCATCAAAGAAGACATTCATCAACGAGAAGCGTTTATTTCATGGAACCAGCCCAAGTGCTGTTGAAGCTATCTGCAAACAAAATTTTGACTGGCGTTTACATGGAAAGAACGCGACCAAGTACGGCGAAGGGAGCTATTTCGCGTTGAATTCCTGGTACAGCGACGCGTACGCCACGCAAGACGACAACTCGTCCAAATTCATGTTTGTTGCAAAAGTTCTTGTTGGTAGTTATACCGTGGGCCAATCCAGCTATCGTAGGCCGCCTCAGAAGGATCCAAGGAACCCCACTAGTGATCTTTACGACTCTTGCGTCGATGACACGTCGTCACCAAATATTTTTGTCCTTTTTGACACTGATCAGTTTTACCCAGAGTACATCATCGAGTATTGTGCTCTTCGGCAAGCCACCTTCAACTCCTATTCAGGTTCTAATCAGCAACCCGCAAGGCCAGTAGCTGCCCCAAGCAGGGCTGCTTCAAGTGGCGTACCGCAGTACAAGCCCGCTGTTATACCTACCGTTGCCAGTGGGAGAAAATCTGCCACACCAGGACCAGCCAGTGGCGTGGGGGCGGCGGCAAGGGCTGCAAACTATTCGAATGCCTCTTACTATGTGTGGTCGAACTACCCGGCATCAAGCGTGCCTACCCATTATTCTAATGCACCTTTTCCTATCGTATCAAACCCGTCACCATACAGTGCGTCGCCAAGTCTTGCGCCTTCAGGCACACCACAGCTCAACCCTACTACTTTCACCAGGCCTTCATCATCGGCTCTCAGAAGCGATCAACGTTCTTCGTTCTCCCCAACTCCGAGTAACAGTCCAAGTACCAAGAAGGGGCTTTCGAAAAACAACAAATGCTCTGTTATGTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8BZ20	Protein mono-ADP-ribosyltransferase PARP12 OS=Mus musculus OX=10090 GN=Parp12 PE=1 SV=3
Q9H0J9	Protein mono-ADP-ribosyltransferase PARP12 OS=Homo sapiens OX=9606 GN=PARP12 PE=1 SV=1
Q8C1B2	Protein mono-ADP-ribosyltransferase TIPARP OS=Mus musculus OX=10090 GN=Tiparp PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000168 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02825 all species →	WWE	WWE domain	Family	Interproscan
PF00644 all species →	PARP	Poly(ADP-ribose) polymerase catalytic domain	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR004170 all species →	Domain	WWE domain	Interproscan
IPR012317 all species →	Domain	Poly(ADP-ribose) polymerase, catalytic domain	Interproscan
IPR000571 all species →	Domain	Zinc finger, CCCH-type	Interproscan
IPR037197 all species →	Homologous_superfamily	WWE domain superfamily	Interproscan
IPR051712 all species →	Family	Mono-ADP-ribosyltransferase and antiviral protein	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45740 all species →	POLY [ADP-RIBOSE] POLYMERASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003950 all species →	Molecular Function	NAD+-protein poly-ADP-ribosyltransferase activity	Interproscan
GO:0046872 all species →	Molecular Function	metal ion binding	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0140289 all species →	Biological Process	obsolete protein mono-ADP-ribosylation	Interproscan
GO:1990404 all species →	Molecular Function	NAD+-protein ADP-ribosyltransferase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K15259	PARP7S; poly [ADP-ribose] polymerase 7/11/12/13	EC:2.4.2.30	Enzymes with EC numbers	-	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074636892.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

59TPM > 0

2Conditions

14.6Max TPM

5.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	32	4.74	14.56
all_coral_tissue · baseline	38	27	6.06	12.74

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.56
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.28
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.10
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.41
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.72
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.11
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.59
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.41
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.17
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.11
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.97
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.72
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.21
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.19
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.11
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.02
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.27
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.02
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.72
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.65
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.54
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.46
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.45
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.52
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.26
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.13
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.11
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.78
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.77
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.72
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.04
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.00
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.74
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.61
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.56
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.29
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.92
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.67
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.62
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.26
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.15
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.82
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.91
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.72
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.62
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.50
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.10
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.94
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.60
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.55
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.21
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.42
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.93
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.57
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.52
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.32
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.18
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.98
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.64
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.