Gene detail

Detailed information of XP_074636962.1 in Acropora palmata

Genomic Location: NC_133891.1:3203188...3220391
NR annotation: XP_029193062.2, E3 ubiquitin-protein ligase MIB1-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074636962.1

ATGGAATACGTCGGTTATAGAGTTGTCAGAGGACCAGACTGGCGTTGGGGAAAGCAAGATGGAGGCGAAGGACACGTAGGAACTGTGCGAAATTTCGAAAGCAATGAAGAAGTTGTTGTTGTCTGGGATAATGGCACTGCCGCGAACTATCGTTGTGCTGGTATATACGACTTGAGAATACTGGATAGCAGCCCCACAGGAATAAAGCACGATGGAAGTATGTGTGATGGGTGCCGTATGCAACCCATATATGGAATACGTTGGAAGTGTGCTGACTGTACAAATTATGACCTGTGTAGTACGTGTTATCATGGGGACAAACATCAGTTGCGGCACAGATTTTACAGAATAAATACTCCAAATTCAGACAGTCCTACACTCGTTGAGGCACGGAGAAAGGGAAAAAAGATCACAGCAAGGGGGATATTCCCTGGTGCAAGAGTGGTGCGTGGTGTGGACTGGCAGTGGGAAGATCAAGATGGTGGCCCTGGTCGACGGGGAAAGGTAACTGAAGTTCAAGATTGGAGCACCACCAGTCCACGCAGTGCTGCTTATATATTATGGGACAATGGAGCAAAGAATCTATATAGACTTGGTTTTGAGGGAATGGCTGATTTGAAGGTAATCAGTGATGCCAAAGGAGGGTCATTTTACAGAGACCATTTACCTCTTCTGGGGGACACACGGTCGTCACGTGCAGCAGGTCAGGGATTACAGATTGGAGATCAAGTCACAGTTGATTTGGACCTTGAAATTGTACAGTCCTTACAGCACGGCCATGGTGGTTGGACAGATGGCATGTATGAGACTCTTGCAACACCGGGAACTGTTGTTGGTATTGATGAAGATCATGATATAATGGTCCTGTACCCTACTGGTAATAGGTGGACGTTCAACCCTGCTATTCTGACCAAAGTTAGTAGTTCTCATGAGAGTTCAGACAGGGTACTTTCACTCTCTTCCCCCACTGCATCCTCTTCCACTGTCACCATTCCTAATACAGCATTGGCAAGCAGTGGCCTGTCAGGAGGAGGCTCCTCATCATCTCAGTTTGCTGTTGGAAACTTGGTGCGTGTGAGTGACGATGTTGAAAGAGTCAAACTCCTGCAAAGAGGTCATGGTGAATGGGCTGAAGCGATGCTGCCAACTCTAGGCAAGGTGGGCAGAGTGCAGCAGATCTACCATGACAATGATCTAAAGGTTGAGATCTGTGGAACTTCTTGGACATATAATCCAGCTCTTTTGACTAAGGTAGCATCTGGCACTGATTCCCCTTCAACTGGGGCTTCTGCTGGAGCTGAGAGATTATCGGCATTGTTGAAGAAGCTGTTTGAGACACATGTTCCAGGTGATGCAGTTGAGGAACTTGTCAAGGCTGCTGCAAATGGCGACTCACAGAGAGTGGAGGAACTGCTCCTCAAGGAAGATGCTAATGTCAATGGTGTTTTTGCTGGTCACACTGCCCTCCAAGCTGCTAGTCAAAATGGTCATGAGGAAACTGTCAGAGTTCTTATTCAGTTTGGTGTAGATCTGGAGGCCGAGGACAAAGATGGTGACCGTGCCATTCACCATGCAGCCTTTGGAGATGAATGCGCCGTTGTGGAGCAGCTAATTAAAGCTGGAAGTGACATGAATGCTCGAAACAAACGTCGCCAGTCACCATTACATGTGGCCGTCAACAAAGGCCACACTGCAGTGGTTAAGAATCTTCTTAGTCTGGGTTGTCACCCCAGCTTACAGGACACAGAAGGTGACTCGCCGTTACACGATGCCATCTCCAAGAAACGCGATGACATGGTCTCAATGCTGCTGGAGGCAAACGCAGATGTAACAGTGGCAAACAATAATGGATTCAATGCATTGCACCATGCGGCTCTGCGTGGAAATCCAAGTGCGATGCGAATACTCCTCACCAAACTCCCTCGGCCATGGATTGTAAATGAGAAAAAAGATGATGGCTACACGGCTTTGCACCTGTCAGCACTCAATAATCACGTGGAAGTGGCTGAGCTTCTCGTCAAACAGGCAAAAGCGAATAAAGATATACAGAATACAAACTTACAAACCCCACTTCACCTTGCAGTGGAGAGGCAGCACACTCAGATAGTGAGGCTGCTAGTTCGTGAAGGAGCTAAATTGGACCTTACAGACAAGGATGGAGACACGCCTCTACACGAGTCACTCAGACACCACACACTCTCACAGCTGCGACAGCTGCAGGATATGCAAGATGTCGGCAAGCTTTTGATGGGTTTGGGGACTCAAGGAGCTGATAAGAAAAGCAGTGCCTCCATCGCGCTGTTCCTCGCCGCAAATGGTGCAGATCTGAATATCAAAAACAAGAAAGGACAGACACCGTTGGATCTATGTCCGGACCCGAATCTGTGCAAAGCTTTGGCAAAGTGTCACAAAGAACGAATGAATGGCAATCAGAAAAACAACGCCAACTCCATACAGCTGGCTGATGTGGATGAGAACGAGGGGCTGGAAGAGTGTATGGTGTGCTCGGACATGAAGCGTGACATGCTGTTCGGACCGTGTGGTCACGTGGCCACATGTTCGTTGTGCTCATCACGTGTCAAGAAGTGCCTGATGTGCAAGGAGGCTGTACAGTCCAGAACTAAGATCGAAGAGTGTCTTGTCTGCTCCGAGAGGACAGCAGGAGCTTTGTTCAAACCCTGTGGGCACATGGTTGCTTGTGAAAATTGCGCTTTACTGATGAAGAAATGCGTGCAGTGTCGGAGCAACATTGAGGAATCTATCCCGTTTATTGTCTGCTGTGGCGGAAAAGCTCCAGCTCCATGTCAATCGAAATCTAGCGGTAAACCTGAGATAAACCCGCAAGAGTTCACTCAATTACAGCAGCAGCTTCAAGATCTAAAGGAACAGGCGATGTGTCCAGTTTGTATGGATCGAAGGAAAAACCTTATATTCTTATGCGGCCACGGCGCATGCCAGCTCTGTGGTGATAGGATGCAGGAATGCCCGATGTGTCGCAAACCCGTTGAGAGGAGGATTTTGCTATTTTAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q86YT6	E3 ubiquitin-protein ligase MIB1 OS=Homo sapiens OX=9606 GN=MIB1 PE=1 SV=1
Q80SY4	E3 ubiquitin-protein ligase MIB1 OS=Mus musculus OX=10090 GN=Mib1 PE=1 SV=1
Q6GNY1	E3 ubiquitin-protein ligase mib1 OS=Xenopus laevis OX=8355 GN=mib1 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000489 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF12796 all species →	Ank_2	Ankyrin repeats (3 copies)	Repeat	Interproscan
PF13637 all species →	Ank_4	Ankyrin repeats (many copies)	Repeat	Interproscan
PF06701 all species →	MIB_HERC2	Mib_herc2	Domain	Interproscan
PF00569 all species →	ZZ	Zinc finger, ZZ type	Domain	Interproscan
PF18346 all species →	SH3_15	Mind bomb SH3 repeat domain	Domain	Interproscan
PF13920 all species →	zf-C3HC4_3	Zinc finger, C3HC4 type (RING finger)	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002110 all species →	Repeat	Ankyrin repeat	Interproscan
IPR036770 all species →	Homologous_superfamily	Ankyrin repeat-containing domain superfamily	Interproscan
IPR010606 all species →	Domain	Mib-herc2	Interproscan
IPR043145 all species →	Homologous_superfamily	Zinc finger, ZZ-type superfamily	Interproscan
IPR037252 all species →	Homologous_superfamily	Mib/herc2 domain superfamily	Interproscan
IPR001841 all species →	Domain	Zinc finger, RING-type	Interproscan
IPR013083 all species →	Homologous_superfamily	Zinc finger, RING/FYVE/PHD-type	Interproscan
IPR000433 all species →	Domain	Zinc finger, ZZ-type	Interproscan
IPR040847 all species →	Domain	Mind bomb, SH3 repeat domain	Interproscan
IPR042056 all species →	Domain	E3 ubiquitin-protein ligase MIB1/2, zinc finger, ZZ-type	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24202 all species →	E3 UBIQUITIN-PROTEIN LIGASE MIB2	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0004842 all species →	Molecular Function	ubiquitin-protein transferase activity	Interproscan
GO:0016567 all species →	Biological Process	protein ubiquitination	Interproscan
GO:0046872 all species →	Molecular Function	metal ion binding	Interproscan
GO:0008270 all species →	Molecular Function	zinc ion binding	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0006897 all species →	Biological Process	endocytosis	Interproscan
GO:0007219 all species →	Biological Process	Notch signaling pathway	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K10645	MIB; E3 ubiquitin-protein ligase mind-bomb	EC:2.3.2.27	Ubiquitin system	ko04121	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074636962.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

77TPM > 0

2Conditions

77.9Max TPM

40.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	42	39.74	77.90
all_coral_tissue · baseline	38	35	41.10	56.02

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	77.90
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	72.89
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	61.66
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	57.85
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	57.54
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	54.92
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	51.73
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	50.09
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	49.56
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	49.49
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	48.78
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	48.34
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	47.88
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	46.68
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	46.66
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	46.40
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	45.57
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	45.39
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	43.98
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	43.98
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	43.28
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	42.85
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	42.78
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	42.28
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	41.93
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	40.87
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	39.15
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	38.75
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	38.13
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	37.40
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	37.21
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.35
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	34.83
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	34.52
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	33.52
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.84
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.41
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.18
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.90
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	30.04
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.21
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.53
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	56.02
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	55.70
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	53.61
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	53.43
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	53.30
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	52.28
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	51.64
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	50.18
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	49.41
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	49.40
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	49.26
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	49.13
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	48.43
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	48.08
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	48.05
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	47.41
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	47.17
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	46.81
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	46.37
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	46.36
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	42.88
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	42.78
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	42.69
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	42.63
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	40.27
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	39.97
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	38.86
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.84
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	36.64
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	35.26
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.96
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	33.66
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.52
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.20
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.67
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.