Gene detail

Detailed information of XP_074637271.1 in Acropora palmata

Genomic Location: NC_133891.1:4323891...4338815
NR annotation: XP_015758876.1, PREDICTED: uncharacterized protein YMR196W-like [Acropora digitifera]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074637271.1

ATGAATACCTTCAACCAGCTCTTAGTCCAAAAATCGACTCTGGGAAAAGGCAATGGAGAAACCTTCAGAGAAGAGTTTGAAAGCAGACATGCTGCAAAGCGTCGTCACTCAATTTCAACGTCTGGTTTTTGGAGAGATCCTGAGAAAGAAAAAGCCAGAAGACAAGAAACAAAGAAGTCTGGTCTCCAACAAATTTGGGACCATTTCAAAAACGGAAACTCTTCCCAAAACTTCATCAACACCCGACTCTCAAAGATGCGTTCGATTCTCAATAACTCTACGATGACACGACGTAGGTCAAGTAATACAGGGTGTAAGAGACAACCAGAGGAGTGCAAACGGCTGGAAGAAGACCTGAATGACCATGACAAAACATGGAGAAGATGGGGACCGTACTTGTCAGAGAGGCAATGGGGAACAGTCCGCGAGGATTATTCCCACGATGGGAGCAGCTGGGAGTATTTTCCACATGATCACGCCCGATCACGTGCTTATCGCTGGGGAGAGGACGGTTTGCTAGGAATCACGGACGGGGAATGTCGATTGTGTTTTAGTTTGGCTTTGTGGAATGAAAAAGATCCTATCCTGAAAGAAAGGCTCTTTGGACTCACTGGAAACGAAGGTAACCATGGTGAGGATGTCAAAGAATGCTACTACTATCTGGATTCAACTCCCACCCACTCTTACATGAAAGCTTTATACAAATATCCCCAGAGTGAATATCCTTATGAGCAGCTGGTCAGAGAAAACAAAGCAAGAACTAAACAAGACAGAGAATTCGAATTGGCTGACACTGGAGTGTTTGATGACAGACGGTACTGGGACATATTCGTGGAATACGCAAAGAACACACCGGATGATATCCTCGTTACGATTACTGTGGCAAATCGGGGACCTGAGGCGGCTCGACTTCACGTACTGCCAACCGCGTGGTTCCGGAACACGTGGAGTTGGGGCTGCAGTAATGGTAATTGCTCCTGTGTGGATGGTACAAAGACCAAAAGTTGTTCTAGGAAGCCGAGAATGATTCAAACAACCCCGAAACTGGTGGAATGCTATCATGACAGCTTAGGCAACTACAATTTCTTTGTAAATGATGGCCCTGATGGAACTACACCAGAGCTGATTTTCACAGAAAATGAAACTAACTCCAAGAAACTCTTCCAATCATCAACTTTTTCGCAGTACACAAAAGATGCATTTCATCGCTACGTCATCGAAAATGAAATCGAGGCTGTCAGTCCATCCAAGGAAGGCACAAAGGCCGCCGCCCATTATGTTCTCACTGTCCCTCCTGGGGAACAACACAAAATTAGGTGTCGTCTCACAGCACGTAACAATCGAGTTCTTTTGCCACTGGATGATAAAGTTTTTGATGACATCGTCTACCAGAGAAAGCATGAAGCTGACGAGTTTTACAAAACTGTTACACCAGAGTCCCTCTCAGATGAAGAAAGGTCAGTCTCGCGCCAAGCCTACGCGGGATTACTGTGGAGCAAGCAATTTTATTATTACGTCATTGAAGAGTGGCTAAAAGGCGATCCCAGCAATCCTTGTCCACCTACAGACCGCTTGAAGGGCAGGAACTCGGAGTGGAAATATCTGCACAACAAAGATGTGATATCAATGCCTGACAAATGGGAATATCCTTGGTACGCTTCATGGGATTCAGCTTTCCACATGCTGCCGATGTGTAAAGTAGACCCTGAATTTGCAAAAGATCAGTTATTGCTGTTCCTTCGCGAGACCTACATGGCGCCAAGTGGACAGATTCCTGCATACGAGTTTGCATTTAGTGACGTCAACCCACCAGTGCATGCTCTTGCTTGTTATCGTGTCTATGAACTCACTGGAAAAAATGGGAAAAAGGACACCGTCTTCCTTGCCAAGTGCTTCCAAAAACTTCTGTTGAACTTTACTTGGTGGGTGAACGTGAAGGACCCTGAAGGCAAAAATATTTTCGGCGGAGGATTTCTCGGACTTGATAACATCGGTTTATTTGACAGATCCAAACCTCTGCCGCCAGGCGATCGTCTTTGCCAGGCGGACGGAACAGCTTGGATGGCTTTGTATTCTGTTGTGATGCTGAACATCTCCTTGGAGCTTGCTCTGACAGACGCGGCCTACGAAGACATGGCCATCAAATTTCTGGAGCATTTCACCAGCATTGCGGACGCCATTAATCAGATGTCAGATGGATTTGGGCTCTGGGACCCGGAAGATGGATTCTACTATGACCATTTTCACAGAGGAGAAGACTTCTTCCCTTTGCGCGTGCGCAGTATCGTCGGTCTTATTCCCTTGATGGCATGCTTGGTCCTGGATGGAAAGTATCTGGACAAGCTTCCTGGGTTTAGGAAACAATTGAATTGGTTCATGGAAAATAGAAGAGATCGAGCTGCGCAAATTGCTTACTTGAATCCAAATGATAACTCATACCTCCTGGCAATTCCGTCCCGTGAACAGCTTCGAAGTATTTTGTCATACATGTTAGATGAGGATGAATTCCTTTCACCTTATGGCATCCGTTCCATGTCACGCTTCCACGAAAGACATCCTTATGAACTGGATCTGGATGGCCAAATGTATAAGGTGGACTATGTTCCCGGGGAATCCAACACTCACATGTTTGGGGGCAACAGCAACTGGCGTGGACCCATTTGGTATTGTGTGAACTATCTCCTGGTGGATGCCCTCAAACGTCATGATTATTTTTATGGAGCCAGTTTCAAAGTTGAATGCCCAACTGGCTCTGGAAATTTCATGCGTCTTCGAGATGTTTCCCTCGAGTTGTCCCATCGTCTGGTGTCAGTGTTTCTCCCTGACAAACATGGGTACAGGCCATGTCATGGAAATGAAAAGCGATATGCAACAGAAGAGGACTGGAACCAACTGATCCTGTTCTATGAGTACTTTAATCCTGAAAGTGGAAGAGGATGTGGAGCGAGTCACCAAACTGGTTGGACAGCCCTTGTTGCTTCTCTGATGGATAAAGTGGCCTTCGCCAGAACAGGGAAATCCATTGGTTTAATAAATTCTAAAGATTCTCAGCTCTTTTCTAATGAAAGCCACAGGATGTATTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q04336	Uncharacterized protein YMR196W OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) OX=559292 GN=YMR196W PE=1 SV=1
O14255	Probable mannosyl-oligosaccharide glucosidase OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) OX=284812 GN=SPAC6G10.09 PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001748 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF03200 all species →	Glyco_hydro_63	Glycosyl hydrolase family 63 C-terminal domain	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR012341 all species →	Homologous_superfamily	Six-hairpin glycosidase-like superfamily	Interproscan
IPR004888 all species →	Family	Glycoside hydrolase family 63	Interproscan
IPR031335 all species →	Domain	Glycosyl hydrolase family 63, C-terminal	Interproscan
IPR008928 all species →	Homologous_superfamily	Six-hairpin glycosidase superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10412 all species →	MANNOSYL-OLIGOSACCHARIDE GLUCOSIDASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005975 all species →	Biological Process	carbohydrate metabolic process	Interproscan
GO:0004573 all species →	Molecular Function	Glc3Man9GlcNAc2 oligosaccharide glucosidase activity	Interproscan
GO:0006487 all species →	Biological Process	protein N-linked glycosylation	Interproscan
GO:0009311 all species →	Biological Process	oligosaccharide metabolic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for XP_074637271.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074637271.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

82TPM > 0

2Conditions

189.2Max TPM

90.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	45	79.94	179.32
all_coral_tissue · baseline	38	37	103.87	189.17

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	179.32
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	169.85
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	149.19
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	138.80
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	129.81
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	127.00
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	125.41
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	119.17
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	118.90
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	107.34
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	107.24
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	103.28
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	102.51
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	102.07
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	96.33
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	95.20
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	87.96
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	87.70
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	85.98
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	85.97
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	83.81
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	79.96
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	79.53
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	79.14
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	78.25
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	76.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	68.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	66.94
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	65.26
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	64.45
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	63.55
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	57.10
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	50.78
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	49.71
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	48.27
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	44.84
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	43.03
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	42.09
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	39.25
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	37.03
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	36.43
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	31.76
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.73
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.24
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.22
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	189.17
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	178.49
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	171.45
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	165.09
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	163.81
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	158.54
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	156.00
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	150.89
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	148.98
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	144.82
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	143.82
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	139.02
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	137.38
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	133.58
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	119.40
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	117.72
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	116.18
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	108.14
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	99.20
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	98.33
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	98.26
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	96.29
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	91.48
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	88.31
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	86.93
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	86.13
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	83.89
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	79.77
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	66.52
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	57.85
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	49.39
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	43.35
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	42.02
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	40.76
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.91
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	34.90
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.41
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.