Gene detail

Detailed information of XP_074637313.1 in Acropora palmata

Genomic Location: NC_133891.1:8247938...8276775
NR annotation: XP_029201154.2, probable 3',5'-cyclic phosphodiesterase pde-5 [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074637313.1

ATGTCTAGTCCTTCGCGTCAAGTCGGAAATCGGCGCTTGCCTCCTCTGCCGAGCGGGTCCCGACAAAGTCCAAGTAATATTCGAGTGTCAAGCGGCAATGGATACGATGCTTCGGCCGCTTCGGTGAAAGCTTCCAAAGGTCATGCTTTGCATCGCTCGCAAAACAACCATAGTGGCCACATAAGTCACATTGATCTGAACGCAAACTTCGGCGATGGACCTTTTCGACCAGCGCTGGGCCAAGGAAAAGCCTTACCTGGAAACGCGCAAGATGTCGACGAGGAATCAGTCCGGAATTATCTCCGGGCAAATCCTTCCTTTTTGGAAGATTACGTGATGAAATATGTCGACCAAGAGCGGTTAGAGCGGTGGCTTATCCGAAAAACGCGAAAATTGAAGAATAAAGGATCAAAGAAAAATGTCAATTCGGTTGAACATGAAAATAATAAACAAAGCGATCCACATCGTCCTTCACTGTCCAAATGGAAATTTTGTGTACACAGTGACAAGAAAAAAATGCTGGAGGAATTAACAAATGACATTCATCAATCACCAAATAAACAAAAAGTGTTGATGGAGTTAGCTAACTGCATTGCATCAGCTTGCCATGCAGATTCTTTCACGCTATACTTGGTGGATGCAACAGGGAAGGCACTTTACATTTACAATCCAAACATTCCAGAAGGGAGGACCTCTTCAAATATCAACATTGAAACAGGAACCACAATTGCCGCATATGTTGCTCACACTCAGAGGCCTCTGAGGACAAATGAAGTGTTAGGCGATGAGCGTTTTCCTGGAGGAATTGGTTTGGAAGACAGTACAGCACAATCTGTGTTGTGTCAGCCAATAGTCCAGTCCAATGGAGAATTGATTGGTGTGATTGAATTATGCCGGAGACTTGGTCATGAAGCTTTTGGAGAAGAAGATGATGAGGTTGTCAACAGCTACCTTGTCTGGGGTGGAATATCACTTTATTATGCAGAGATGTTTCAAAACATGCAGAGGCACAGAAAGTTAACAGAATTTTTGCTGAATGTGACAAGGTCAATATTTCAAGATATTGTCAGCATGGATACAGTTATTATGAAGATTATGAATTATGCACAAACTCTGGTAGATGCAGACAGGACGTCATTGTTCCTTGTGGACAACAGGACAAGTGAGCTGTATGCAAGAATATTTGATATTGGTGGCAGTCTGGAGGACAGCCGCTCCTCGAATCTGCAAAAGGAAATCAGGTTTCCAAAATCGAAGGGTGTAGCTGGACATGTGGCTACCACTGGGGAGACACTAAACATCACAGATGCGTACCACGATGAACGATTCAACAGACAAATTGACATCCAGACAGGTTACACAACAAATACCTTACTTTGTATGCCCATCTTCATCAGAGGAAACATTATTGGTGTTGTTCAGATGGTCAACAAAAAGAGTGGAGTTTTTACTGCTTCAGATGAAAAGTCTTTTCAAACATTTGCTATTTACTGCGGGCTGGCTCTTCATCATGCTAAGCTTTATGACAAAATCCGAAGATCTGAGCAGAAGCACAGGGTTGCGTTGGAGGTTCTATCCTACCACAGCAAATGTTCAGATTATGAGTACAAGAACATCACGGAAATCGAAGTGATGGATCCTTATCCAAACATGGAAACGTATGCATTCGACTCATATGCACTGTCTTCTCAGGGGTTGTTCCTGATGCCAAGCCTGGTGATTCAAATGACAAAGAATCTCTTTTCACTTCAAAGATTTGGGTTGGATGAGCTTCGGAGATTCGTTCTAACTGTAAGGAAAAACTACAGAGATGTGCCGTACCACAACTGGACCCATGCCTTCGCGGTTGCACATTCCATGTACCTGGTTATTAGATCTGGAAACAACAGGTTTACCGCTCTTGAGGCTCTGGCCATGTTCTTTGCTTCATTGTGCCATGATTTGGATCACAGGGGTCGCACAAATTCGTGGATGAAAAACGAACAAACGCCTCTCGCAGCCGTGTACAGTACATCGACAATGGAACATCACCACTTTAATCAAACAATCACTATACTTCAGCACGAAGGACACAACATCTTCTCGCATTTGAGCCCGGCAGAGTACAAAACAGTGCTGGGTTACATGAAGGAGTGTATCCTTGCCACTGATCTGGCATTGTTCTTTGGCAACAAATCCAAACTTAAGGATATTGTCGAGAAAGGGCAGTTCACCTGGGATAATCAGGAACACAGAAAACTTCTTCGTGCCATCTGTATGACTGCCTGTGATTTGTCTGCTTGCACAAAGCCCTGGGAAATCCAGCTGGAAATTGTCAAAGTTATTTATCAGGAGTTTTATGCAGAGGGCGACCTGGAGAAGGCTCAAGGAAAAACACCCATTGCAATGAAGGACCGCAATACAGCGCACGAGTTACCAGCGCACCAGGTTGGCTTTCTGGTTGGAATTTGTTTACCGTGTTACGAGCTCTTGCAGAAATGCATTCCCGAGACAAAGCCTCTTGTGGACGGATCTCAATCCAACCTGCAGAAATGGTCACGGATGGCTCAGCATAACAGAGCAGCGCTGGATGCGATGAACAAGAACTCGGATGAATCTGGGAAGAAGGGAGCCAAGGAAAGTGGCAAAGATAACGCCAGCAAGAGCGACAAGAAAGACGATGATTCCGAAGAAAAACAAGACCTAGAAGAGAAAAAGTCTGAAAATGAACAAAAGGAATCCATAAAGGAAGAAGAAAAACATGTTGACGAAGAGGAAAAGGAAAAGACAGAGAATAGCATTGAGAATTCAGAGGCCGACAAAGAGAAGGCCTCAGATTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P91119	Probable 3',5'-cyclic phosphodiesterase pde-5 OS=Caenorhabditis elegans OX=6239 GN=pde-5 PE=3 SV=3
Q8CA95	cAMP and cAMP-inhibited cGMP 3',5'-cyclic phosphodiesterase 10A OS=Mus musculus OX=10090 GN=Pde10a PE=1 SV=2
Q9QYJ6	cAMP and cAMP-inhibited cGMP 3',5'-cyclic phosphodiesterase 10A OS=Rattus norvegicus OX=10116 GN=Pde10a PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001516 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00233 all species →	PDEase_I	3'5'-cyclic nucleotide phosphodiesterase	Domain	Interproscan
PF01590 all species →	GAF	GAF domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR003018 all species →	Domain	GAF domain	Interproscan
IPR023088 all species →	Family	3'5'-cyclic nucleotide phosphodiesterase	Interproscan
IPR002073 all species →	Domain	3'5'-cyclic nucleotide phosphodiesterase, catalytic domain	Interproscan
IPR036971 all species →	Homologous_superfamily	3'5'-cyclic nucleotide phosphodiesterase, catalytic domain superfamily	Interproscan
IPR029016 all species →	Homologous_superfamily	GAF-like domain superfamily	Interproscan
IPR003607 all species →	Domain	HD/PDEase domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11347 all species →	CYCLIC NUCLEOTIDE PHOSPHODIESTERASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0008081 all species →	Molecular Function	phosphoric diester hydrolase activity	Interproscan
GO:0004114 all species →	Molecular Function	3',5'-cyclic-nucleotide phosphodiesterase activity	Interproscan
GO:0007165 all species →	Biological Process	signal transduction	Interproscan
GO:0004118 all species →	Molecular Function	3',5'-cGMP-stimulated cyclic-nucleotide phosphodiesterase activity	Interproscan
GO:0010754 all species →	Biological Process	negative regulation of cGMP-mediated signaling	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K18438	PDE10; cAMP and cAMP-inhibited cGMP 3',5'-cyclic phosphodiesterase 10	EC:3.1.4.17 EC:3.1.4.35	Morphine addiction	ko05032	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074637313.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

55TPM > 0

2Conditions

11.4Max TPM

4.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	31	3.83	11.40
all_coral_tissue · baseline	38	24	4.25	11.24

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.40
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.66
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.34
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.32
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.98
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.84
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.63
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.55
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.53
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.96
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.39
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.24
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.12
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.96
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.77
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.77
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.65
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.58
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.24
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.97
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.59
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.13
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.08
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.04
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.74
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.61
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.55
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.32
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.14
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.13
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.94
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.24
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.54
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.57
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.49
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.35
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.23
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.22
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.12
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.97
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.83
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.68
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.31
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.16
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.09
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.48
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.42
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.40
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.22
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.15
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.84
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.45
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.66
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	2.14
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	1.81
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.