Gene detail

Detailed information of XP_074637477.1 in Acropora palmata

Genomic Location: NC_133891.1:15760394...15778017
NR annotation: XP_029190769.2, eukaryotic translation initiation factor 4E transporter-like isoform X4 [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074637477.1

ATGGAGGTCAGCGAGTTGTCAGAAGGATGTAATGTCGTTGCAACTACAAAGGAAGATTCATCCAGTGACGGGAAAGTTGTGAAGAGTGACGAGGTCTTGGCTTCTTCGACGGATAACGATGAGAAGACAACAAGAGAAAACCAGCCACGTGTTACGTACACGAAGGAAGATTTGCTCAATTTAAGAGAGTCTCCTGCATCCAAACTATGGCCCTCTGTCTTTTCTGATGAATATGTTAGAAGTGGCATTTGGGACCCGGAACCCTGGCACCAATCTCACTCGAGAGAAAAGAGATGTGTATCGCCTGGAGAAGAGCTCAAAAAGCAGCTACTTCTGATTGAAGATGGTATTGTACTGAGTCCACAGCGACAAAGCTTTGTGCAAGGCTGTCACATCCCTCAGAGTGTACCAGAGAGGCGTTCAATGCAGGAAAGAGGAAAGGTTGGCTTAATTAGAGCAACCGATCGAGACAAGGATGGAAGAAGCAGACTGACTGGGCGTATGGGAAAAGGAAGAGCTTTGGATTATAAAGAACTGATGCCTTTGCAAGATTCAGATACTCCATCTGGAAAGTACAGTGGGACACAAGAAAGAGTGGAGAGGATTGACAAAGGTAGAGGGAGTGGCAAAGACAAAGAGAAAGGATTGAAGGAAAAAGAATGGAAACGAAGTAAAGAAGAAAGAGAACAAGGGAAAAAGAAACAGGGTCAAAATAAGAGAAATGAGGAACCTGAGTGGTTTACATATGGTCCATCAAGTCAATTTGAAACAATGGAACTCAAAGGATTTGACACCCAGGAATCATCAGATCACAAGAAAGATAAGGAAAGGCGCAAATCGTTGTCTGACGAGATAAAAGCAATTTTGTCAGTTGGGAAGAAAGGACTTTTAAATGGTGAAGTGACTGAATCGTCCCCTGAAACAAGCGGAAGTGCATCTCAAAACAGCGACCAAGACAGGAAGATGGCCAGCGCTTATGACAACCTTAAAGCCAAAGCCTTTGATATCAATGACTTCTTCATCGGTGACAGCTTGCTACCTTTATCTGGAGTGGTGGACCAGAGTAGCAGCAGATTTTGTCAGTTCTTTGGTCAACCAGGAAGCAATTACAGTAGCAGTAGGAGTGGAAGTGCAGGATGTTCAAGTGGCGGCCTTAATACCCCACGTACGCTGTCTCCAGGGGCAAACCATTTCTTCACCCCGATAACCCCTTCAGTAGACGATGGCATTGAATCCCAAGAGCTTGCAGACGTGCTCCAGAAGACCCAAGTTAGCGTTCAGCCATTATTAGACGAGGTGATGTCGTCAGGAAAGGAAAAGGGTAAAGTCATGGGATCCGTGCGTTTGGAGGATATTGAAGCAGACGTGGCAAAGGACAGTGACATCTCCACCGAAAAAGACTTGAGCAATGAGGAGAAAAACAAGGAAATCGTCGGCGATGGTGATGATGAAATGCTAGATTCTCAGGTGAAGATGGAAGCATTCAACAGACTTGTGGAGAAGATGAAAACATCAGGCACCTTACCAGAGAAGCCGCAACCTGCGATCTCTGGATTGCCAACTCATCTATTGCCGAGGCCTCCATCTCCTAAAAAGAAAAGCCCAAGAAATTCTCCCTCTCCAGTTCTGGGTTTGAGAAGGTCGCCGTCACCAGCTGAGCTCTTGAGAATAATGACCATGCAGGCGCCATTGACAGAGCTGCGACCTCCATCTCCCGCCCAAGTTGTGCCGCAGATGAATAGAGCAACATCTCCTTTGGAATTGTTCCAGAAATTCAACTCTTTAGTTACCTCGCCGCAGGAACTTTTTTCCTCCCCACTGTTACAAAGGTCATCCTCACCTCTTGCTGTACAGGCCCGATATAGACGCAGCCCTCCTCTTGGATTTGATCCCCTTTGCATGCAGCTGGTACCAAACCAAGGTACACCTCTCTACAAAACGCGACCGCAACGTGGCGATGTGCCACGTCAAGCCAATCAACAGTCCGTGAGGAAGTCACATGAGAAGCAAGATTTTGAAGGGAATACGCCCGAAAAACGTGGCCAGAGACCTGTGCATTCAAAGCCAAGTTCGTCTCATGCCGGTAGTCCCTACATACCAGACAGGTCTTTCATGCCAACAGCTGTCATGAGAAAGATTCAACAGGATCGCATGGATCAGAAGATCTCAAAAACTGAAGGGAAACCATCGGCCTTAGATTCGTCTAAAGAAATTACTGACCACAGTGGAACTCTTTCTTTGGGGATTCGCCCAAAGCAGTTATTGACCAACCAAGAGTCAGCTCAACTGAATAACCGGTCGCAAGCTGAAGATGCGATGGTCAAAGGATCGTTATTTGCTAAGTTCACAGAGGCCGATGAGAAAATGCCTCCGCCTCAAACAAGTACGTCAAAACAAGATACTTTAATTAAGCCGGCTGCCTTCAAACCTTTGCCAGGATCTCCTCAAGCTCCGTTCTCCAGCCTTAATAGTGGCATTCACTCTGAGCCAGCATCTCCTATGCATGCATTTCACCAAAGTGCTTCCTCGATGCTTCCAAATTCAGCGCCATGCACTCCACAGCGACATCCCTTGGTTGACAAAGCTAGTCTGCTCTCACCCCTACAGCTAGTCTCCAAAGGACCGTTTACCAGGGAAGATGGCAACAAGTCTTCCGTCGGACTGTTTGGGTCAAATGTTTCCCTCGAAAGTCATTCGAAAAATATTCGTGGCAGTATTACCAAAGTGGTGACAGCCAGTGAAGGGAGGCCACTGGCTCATTCATATGAGCAACTGGCTCATGTTGCAGGAGAGAAGATGGCAGCTGGGGAAGACACATTCCATGGAAAGAGAAGCGAGAATTTGGTAGGAAATAATCCGGTTTCTAAAGGTGTCTCAGCTACGTATGGAGGGCATAGAACGGGTGGCAGTGAGGTAACAGCTCAACAGGAAGGTCTGACAACAATGTATCCAAGACAGAGGATTCCTGGGGGAGATGCAAGGCCTACTCCAGTTCTTCATGCCCCTCGACCATTCCAAGGTCCCCATGGACTCTGGCCCAGGGCACACATGCCAAACGGACAGCTAATGTCACCTTCAGGACTGAACGCATTGCATGGTCATCCTGGACACACACCTTTTAATTCCCCAATGCATAATATGGGAATGCCACCGAGACCTGGTTTGCTACCAGGAATGCTGCCCCATCATGTCCATCCCGCGTACTTGAGAATGATGTCTTCAGCGTCATCACCCATGGGGATGCCACACCCTGGCATGACTCCAGTATCCCAGAGAATGCAGATCCCGCATGTAACTGGCAGGATCCCTGCTATGCCAGGGCACCACCCGGCGATGAGGTATGGAGGGCGTCCTCTACCTGGCTACCTACCTGGTAACCCAGCTGCAGTAGCAGCAGCAACAGGAGCGATGAAGGGAGCTCGTTCCCCTCACATCCCCCCGCAGTCTCTTGTACAACCCAGTCATGGTAGGCAAGTGGCGAGCCCAGTGATGAACCATCCACCACAAAGTCGTTCCCCCGCAGTTGGGAGCAACATCCTATCAAAATGGTTCAGCGATGAATTCTTGCAGCAGGCTCACCCTGGGCAGCGGTCAGCCACGCCTGACTTTGCCAGGAAAGTGGTATCAGTTGAAGAAATTGAGCGGCAACAGGCTGCGACCATCAACTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9EST3	Eukaryotic translation initiation factor 4E transporter OS=Mus musculus OX=10090 GN=Eif4enif1 PE=1 SV=2
Q9NRA8	Eukaryotic translation initiation factor 4E transporter OS=Homo sapiens OX=9606 GN=EIF4ENIF1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003915 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF10477 all species →	EIF4E-T	Nucleocytoplasmic shuttling protein for mRNA cap-binding EIF4E	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR018862 all species →	Family	Eukaryotic translation initiation factor 4E binding protein	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12269 all species →	EUKARYOTIC TRANSLATION INITIATION FACTOR 4E TRANSPORTER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003729 all species →	Molecular Function	mRNA binding	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0017148 all species →	Biological Process	negative regulation of translation	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K18728	EIF4ENIF1; eukaryotic translation initiation factor 4E transporter	-	Messenger RNA biogenesis	ko03019	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074637477.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

74TPM > 0

2Conditions

40.3Max TPM

17.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	40	16.61	37.36
all_coral_tissue · baseline	38	34	18.12	40.34

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	37.36
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	35.21
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	32.96
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.98
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.83
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.63
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	26.22
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.61
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.37
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	25.06
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.94
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.45
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.38
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.86
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	23.16
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.68
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.05
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.57
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.54
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.46
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	19.06
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	18.82
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.74
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	15.65
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.20
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.18
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.70
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.08
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.95
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.88
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.13
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.98
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.18
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.96
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.72
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.72
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.77
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.33
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.38
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.36
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	40.34
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	30.40
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.25
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.13
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	27.91
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.97
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	26.18
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.21
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.56
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	24.05
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.90
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.83
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.81
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	23.49
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.97
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.68
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.96
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	21.04
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.70
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.15
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.94
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.45
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.37
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	16.97
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.34
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.36
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	14.02
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.85
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.26
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.26
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.74
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.56
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.34
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.67
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.