Gene detail

Detailed information of XP_074637795.1 in Acropora palmata

Genomic Location: NC_133882.1:19323549...19327055
NR annotation: KAJ7388973.1, Shieldin complex subunit 2 [Desmophyllum pertusum]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074637795.1

ATGGTGGATGAAAACTTCTTCAAATCTCCTAAAGTGTTGATTTTTACGGCGCCGGTTTTGTGCCGTGGATGTATTGAAAAAACGCCAAAAATTGTTGAAGAGGGAAACGAACCATTTGATCGTCGGTGGAGGAAATCAGTCGTAACTGTCGGTGAAAACTTACTTACTTCTTGGAGAAAACAAGGCGTGTGTAGCAGTGAGAACGATCTCACTGAAGCTAGTGACATCAGGTTGGATTATGATCCACTAGCAATACAAGAGTCAGTTTATTACTACTTGGAAAGTGAGTTCAATAGTAACAACAGCTCCTCAATGCCTGTAACCCAGTTTTCGTTTGGTTTTGAAACTGCACTGCCAAATACCGCTGGTAACATTGAAGGCGAGGAACCTTTGCAGAAGGAATTCGAAGATTTACGATGTGCAAGTCAAAGGCTTCTTGCTGAACATGACACTTTCAGCTCAAGTGTCGAAGATGGGAGAGGACTCAAAAGAAAACGCGACAAGAGTCCCACTTGTGAATCTAAGACCGATGCACATCTGTTGACCATGGAGGATGTGTATACTCAAGACAAATACCTTTCTTCATCTGGTAAAAGCAGAAGCCCAGCAACCACAACACAGAGGACACAGATCAAATTATTTTCAGATCCTGGTCTTTCCTCAAAACCTTCAGACCCTGATAAAGAATTTGGGGGTTTCATAATGAATACAGTTCCCAAAGTTTGTGATGAATTAACCCTGCTCAAAGACTGTACGACAGAAAACGCAATCGTTAATGTAGTGTTTATCGTCATGCAAGTCAATCACACTCGGGATGTAAAGATCAAATCTGGAGCTAATGCGGGGAGTTTTGTAGCAGTCTCTTCTATTCTAGTTGCTGATGAATCGAAGTCTTGCTTCAAAGTAACACTTTGGAGAGAGGCTTCAAGATGGGTAGACAAAGTAAGCCCAGGAGATTTTGCTGTTGCAACTGGAGTCAAGGTTGGAAAGTGGCGTGATGAGTATGTTGGCCAAACAACATTCAAGTCGAGTTTCTACAATCTACATCAACCAAAATCTGTGTTGTCCCATGCGTGTTTAAAGTTAGTCTCCCAAGAAAGAATCAACAATCTTTCTGGCTGGGCGAGATCAGAGCACCCTTACCTTTTTGCTGTTTCATGTGTCAAGAAGGCTGTGGAATTGACTGAAATAGCGCAGCTACGCGATAACACTTTGGTGAACTTCAGAGGAAAAGTGATAAGTGTGTGCATGAATTCTACATCAACTACTTACCGTTTTGGTGATCAGCAGCTGGCGAAGATAACAGTTGTTTTAGCTGAGCGACCAGGCGACATGATCAAGCTTTCTCTGTGGGGAAGACAATCTCAGTGGATGAACCAACTGCAAGAAGGTCTGGGAAGTGTTTGGGAGTTCCAGTACCTTGCAGTCAAATACAGCGCGGATACCGGTTGTGTCTCCCTGCACACGACACCAAGGTCAACGAAGATAAAGCTTATCAAGGATGAAGACAAAAAGGCGAAAATAATTGGGGCTCAATCTCATGAAAGTGCCAATGACAGGAGAAAATTCTCGAGTGTACGCGATTTGCTGCAGTCGAAGTACACAGGTTTAGCCGAAATTAAAGCTGATATCGCATCGTTGCAATTTCACTGTGGACAAGACGAAATCATTATTATCGACCAAACTACCTGCTCGTATAATCAACTCAAAGACAAGATTGGCAAATTAATTTACTTTGGCTGCGGATCTTGCTTGCGGGCTCTTGACCAAGATCACAACGGTGTTTACGGTCAGTGTGACCACTGCGTGACGGCCAATCCCGATTATCAATACACCATTGACTATTATTACCAACCGGTGAGATTACTTGTGAGAGACGCATGCGCGGCCTTAAAAGTAGAGGCGTTCAGTCGCGTCGTTTCCTGCCTTTTTAAGGACTATCCTGCCAAGTCAGCGATGCGAAAACAAGTTGATGCTTCAGCGCATGATGATGGTTTTGTAGAGAGTTTTATTGCGTTTTTGAACTCACTCGTTAATGGAGTGAAGCGCAAAATGCTAATTGCCTGTCATGTTGATGTCGACGAAAATAGCTTCGTTAAGAACAGAAGTTTCACTCTCCTGGAAATTGAGGTATAA

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0009323 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF15793 all species →	SHLD2_C	Shieldin complex subunit 2, C-terminal	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR029715 all species →	Family	Shieldin complex subunit 2	Interproscan
IPR012340 all species →	Homologous_superfamily	Nucleic acid-binding, OB-fold	Interproscan
IPR031589 all species →	Domain	Shieldin complex subunit 2, C-terminal domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR14495 all species →	SHIELDIN COMPLEX SUBUNIT 2	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0010569 all species →	Biological Process	regulation of double-strand break repair via homologous recombination	Interproscan
GO:0035861 all species →	Cellular Component	site of double-strand break	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K26129	SHLD2; shieldin complex subunit 2	-	DNA repair and recombination proteins	ko03400	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074637795.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

34TPM > 0

2Conditions

5.8Max TPM

1.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	14	0.80	4.19
all_coral_tissue · baseline	38	20	2.43	5.81

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.19
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.46
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.27
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.89
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.85
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.79
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.68
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.59
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.54
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.16
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.05
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.87
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.79
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.57
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.81
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.70
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.69
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.37
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.30
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.22
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.18
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.16
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.07
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.04
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.03
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.84
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.81
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.36
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.80
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.73
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.62
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.54
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	2.77
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	2.24
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.