Gene detail

Detailed information of XP_074638596.1 in Acropora palmata

Genomic Location: NC_133892.1:21116403...21130399
NR annotation: XP_015752265.1, PREDICTED: alpha-protein kinase 1-like isoform X2 [Acropora digitifera]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074638596.1

ATGGAAATGTTCCACACGTCACTTAAACCCATTTTGCTCCATAGCAACAGCAGCAGCAAGCATGAAGAAGTGAATGACTTTGAATTATCAGTTTCAATGGAGTCCATAATTGCAAAGTTAAAAGGGAATGAACCATCTCCCATCCTTATTCATGGTGGACCTGGATGTGGACTGACAACACTTCTTCTTGGGATCTGTAAAACACTTGTTGAAAGTAGTTGGCTGGAGAAGTCTGACATGCTTTCTTTCAGAGTAAGACGAGGGTGCTCTGTGCAGTCTGTGTGGAGGTTTCTGAGTGAAATTGCAAAGACAAAGCATGATAAAGACACTGCTTCATTGCTTTTGCAATCAAGCACAAAATTATGTAAGAAGGATGAGGCAGCACAAAAGTTTATTGTATCTCATTTCAAGCTCATCTGTGTGGATGATGCGTTGGCAGATGGAGGAGTAGTATGGTTGTATCTTTCAAAGCTGTTTTGTGATATAAATATGTCTCTTATCGCTGTCTCTTCCCAAGTAAAAGCTTCTGATCCTGAAACCATACAGGCAGAACAAAGCCTTATGTCTGTGAAGTTGAAAGGTGTTGGTAAAGAGTCATACAAGAAATTGCTCGCGGAACAACTTCCCTGCTGGAACTTTGATGATGACAAACTTTCCAGAATCCACTCTGTATTGAATGGTAACCCATCATCACTGAAAATCTTTCTAAATGCTGTGAAGGAATTTAATCTTCCACAAGACAGTGTTGATTGTGGTTTTCTGGTCAGTGCTGTAAATTGTAATGATCAACAAGAAAAGCAGAGTGTCTGTAATGTGATTGAGTTTCTATTTAAACGGTTGACATTTCAGGAGAAAAAAGTATTTTATGAACTTTGTTTATTGCGAGAACTACTTCCCATTATTCATGTGCCTGACGAGGTGGAAACGCTTGTGAGACTTGGCTTGGTTAGAAAAGAAGTTATTGCCAAGGACACAGGAACAAATAATGGCTCTCTACACGCTCTATCAGTATCCTCTTGTTTTTGCATTAACTCATCGCAAATTAGAAGTTTCATAGCTGACAACAGTGGTCAAAGCCCTTTCCAGATTCCTAAAAATTTCAGTGTCTTTAATTTGTGGTTTGCACTTCTTTCTGAAAAACTTTGTCAGCTCATCATGGATGCACAAAGAAATGCTTGGCCCTTTGTTCCTGAAAAGTGGCAGTATTCTTCAAATGTTGGAGAGGAGGAGAAATACAATGTAAAGGAGCTGATCACTGCAAAGAACCGAGTTGTACCATACCTGACTGAACAGGACATTTTGGAGGAGTGTTTATATCATGCAGTTAAGGAAAATAATTACGATACAGTGGCAGCACTGGTGTTTGTGATGGACAGGTTCAGTTATTGGCAAGGAAGTTCTCACAAAACTCTGGAGCTTGTTGATTACTTGAAGACAAACAGCCCAGTCACTCCAATTGCTCCACAGTTGCTTATACGAAAAGCCAGGGTGATGAAAAATGCTGGCAATCTGCATGGTGCAGAGTATGTTCTTGACGAACTCCTTATCAAAAAGAACCAAGTGGAAGAATGGGTTTATAAAGAAAAGCATGACCATCAACTTGTCAGTGCAGTTTGCATTCAGATTAAGGGTGATATCCAGTTCAACCTTGGACAGTGGTCAAAAGGAGCAAAGTTTCTACTTGAATCTCTGATTCTCTTCAGCACTCTTCCCATTCCTGATACCAAAGGCATTTCATCAAGCCTTTCTATTCTAGCCAACTGCCTGGACCAAATGAGTATACAAGATTATCTTCCTCTTGCCCGATCATTTGGCCTCACATGTTCCCATCCACTGTTGGAAGCTTATGTCTGCTCATGTGAAGCTGCAACAAGATCACAGTACACTCCACTATTCTATGCTAGACACAAGTGCCAAGCAGGTGAATTCATGTTGTCTTACTCAGATCTCATTCCTGATGCAGTTCAAAAGAGAGGGTTTTTAAAGATTGCTGCAAAAGCTTTCAGAGACAGCATTGAAGCCCACAAAGAGTTGAAGTCCCTTAGCAGTCGTGAAGAGTTCTATGTGTTTGTTTGTGCAGTGTACAAACTGGGAATAACTTACCAATGTACTGGTACACAAGGTAGCATTAAAAAAGCAGGTGACATAAAAGAAATGTCAAGGGTATTGTATGAGCATTATTGCTCATTTACTGAGACTATTCTATTAGACAAGGAAATCACTGATCTGATAAGTTGTTGCCTCAGGTATCTTCATCTGAAGCAATTTTGTGATGAAGAGGATCATCATGCTAGGGAAACTTTGATCAATACCAGTGGAAACTTAGACAAGAATGACACCAAGGGGGAAGGAGGTACCAAGACACCAAACTCCTCACCACTGGAGACATCAGATCTCCTAGGGATGCAACCAAGCGAGGCATTGGGTTTAGCAGACTATGAGAATATTTTGAAAGTACACCTTGGTGGGTACACAGTAACAGACAAACTAAAGGAAATGTGGCAACACACAGAATGGCACGACTTTGCTTCTGAAGTGCTTAATAGAACTCTGGTGGGCTTAGACAAGAATTCAACTGACGTGGATGCACTGACTGTTGATCGGAACAGTGACACCAAGAACTGTGTATCAGGATCTGTGAGCGGGACTGTCAATCGTAGCATTGCCACACAGGATTTGAAGCAGGATACTGCATCATTGCCAAATGAAAGGTTACTGACTCCTGAGGTTGCAACAATTCAAAGTCAATTCCATGGGCTTAATGTGGGTTCAAGTCCACGAAGAGTACAAGGTGCCATTGTCTGGAAATTTGACTTCTCATGTATTGAGTGGATGGGCCAGCAAACTCTTGCTTTTGTTGGAGAACCATTGGATTTAGCAAAAGAAAAAGAGGGGAAACAAAGAGATGCCTTCATGGTTGAATTCCTTAATCAAGAGGATCCATTTGCAAAATATGTGGCAAAGCGTTACAAAGAAGCCGAGAGTTTGAAGCAGTATCAACAAGATATCATTTGTCAGATGACCGCTCGTTACTATGCCATGCTCTTTAATCAACAACTAACTGAAACAGATTCCAAGGTAGGCCACATCGAGTTTCTTCCTGTTGCCTTACTCCAGTTGGTAAACTCCAATGGTTATCTTAGTGAAGTCTACAATGTGGAACGCTACATGGCCGGAGACTTTGTTAAGTTCACTAACAATGCGAAATTTGTTCGGAATCGAGGTACATTGGTGTCAGACCTAGTTCTGGCATTCTCTCATTTCACTCATCAAGCGTCCAATAATGAGCTGATAATTGTGGATATACAAGGCTGGACCCCTGCTTCAAATGAGATTGGCTGTATCTTCCTTACAGATCCTCAGATACATTCTGATGTGTACCGGTGCTATGGGACGGGAAATTTACGCCAGGAAGGTATCGACACCTTTTGGAAAGAGATGCATCCTGAGTGTAACCATCTCTGTCAGAAAATGCACCTGACCCGGCCATCTCAACAGTTGGACAACCCTTAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q96QP1	Alpha-protein kinase 1 OS=Homo sapiens OX=9606 GN=ALPK1 PE=1 SV=3
Q9CXB8	Alpha-protein kinase 1 OS=Mus musculus OX=10090 GN=Alpk1 PE=2 SV=2
P42527	Myosin heavy chain kinase A OS=Dictyostelium discoideum OX=44689 GN=mhkA PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003041 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02816 all species →	Alpha_kinase	Alpha-kinase family	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR004166 all species →	Domain	Alpha-type protein kinase, alpha-kinase domain	Interproscan
IPR011009 all species →	Homologous_superfamily	Protein kinase-like domain superfamily	Interproscan
IPR043529 all species →	Family	Alpha-protein kinase 1	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46747 all species →	ALPHA-PROTEIN KINASE 1	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004674 all species →	Molecular Function	protein serine/threonine kinase activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0006468 all species →	Biological Process	protein phosphorylation	Interproscan
GO:0002753 all species →	Biological Process	cytoplasmic pattern recognition receptor signaling pathway	Interproscan
GO:0005929 all species →	Cellular Component	cilium	Interproscan
GO:0045087 all species →	Biological Process	innate immune response	Interproscan
GO:0048029 all species →	Molecular Function	monosaccharide binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K08868	ALPK; alpha-kinase	-	Protein kinases	ko01001	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074638596.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

68TPM > 0

2Conditions

32.7Max TPM

10.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	35	7.47	24.70
all_coral_tissue · baseline	38	33	13.10	32.67

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	24.70
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	21.95
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	20.59
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	17.05
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	14.59
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.99
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.11
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	12.50
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.24
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.95
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.74
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.60
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.56
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.12
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.93
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.34
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.98
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.90
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.39
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.30
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.20
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.16
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.38
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.19
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.21
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.98
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.90
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.41
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.39
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.14
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.94
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.93
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.47
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.28
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.48
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	32.67
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	28.01
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.40
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	25.27
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	22.42
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.83
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	20.43
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.72
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	19.53
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.89
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	18.43
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.99
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.87
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	15.31
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.93
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.72
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.09
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	13.07
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.98
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.66
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.65
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	12.28
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.84
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.59
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.16
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.08
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.51
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.10
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.15
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.42
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.39
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.23
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.09
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.