Gene detail

Detailed information of XP_074638652.1 in Acropora palmata

Genomic Location: NC_133892.1:20995597...21010110
NR annotation: XP_029209779.2, twinkle protein, mitochondrial-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074638652.1

ATGACTCTTAGGTTTTTCTACACGCCACTTCTATCATGGCGATCTCAGCTGATAAATACTATGAGAGCTGCACATCATTCCCGGAGGAATTACAAGTTTTTATGTTTAACGCACGCACAAATCCAACAAGAACAGTCAGAATTTAACCACGAATTCTCCACTGGAAAAGACAGACGACTTTGTTTGAACTTTAAAAGACAGCAGCAGACTCTGTCAAGTGATTTTGGAGCGCATTTGCCGAGTGTAAAGCAAATGGAACATTTCTTGTCAAACCGTAGAATTTTGTTCGAACATGGCCACACTTCACTGATTGCAAGTTGTCCATTTTGTATCAAGAAAGAAAATGCTTCAATGAATGTAAAAGATCACACCTTGTATATTAATAAAACAACTGGAAGCTACCTTTGTAGGAAATGTGACGTCTCCGGAACATGGCAAAAATTCAAGATATCCTGTCAAGACAATCACAATAAAGATTCTAGTAGGGTCCTGTCACTGGAGAACAATCCTGACAGTATTACTGATCTGGGTCATGTCAGTCAAATATGGAATGCCTCTACTCCAATCAACAAGTGTTCTGATGAAATTTGGCAACAGCTCACATCACAGTTTCAAGTCCATGGATTAAACAAAAACATTCTAGAGAAATTTGAAGTGAGATTTACAGAACATGAGTTTAAAGATGTGAAAGGAAATACAAAGAAACACAACTGCATAGTATTCCCTTGGTATGACGTCAACAACTCTACAGTGAAAGGAGTAAAACTTGTCAAGCTGGAAGTAAATTCATCAGATTCAAGTTTCACCATAGAACCACGCCAAGGGTTTTTGGGACTTTTTGGTGCGAATACAGTTGATCCTGAAGCCAAAGAGGTGGTTTTGGTAAAAACAGAATTCGATGCCATGGCTGTCAATCAATCAACTTCATTTCCTGCAATTTCTCTTCCACTTGGAACAAACTCACTTCCACCTGAGGTTCTTCCTCAACTAGAGCAATTTGAGAAAATCGTTCTTTGGTTTGGCAATGATGTTTTCTCAAGACAAGCTTGCAATCAGTTCTCACGGAAGCTCAACTTAAATCGGTGTTTCCTTGTCAGGCCAAGTGGTGATAACACCCCAGCAGATGCATTAGATGCCCTAAACTCGGGTTCTGATCTTACATCATTGATTTCTGCGGCTCAACCAATAAGTCATGAAAAAATTACTACATTCCATCAGCTAAGAAGTGATGTTTATGATCAGTTTGTGAATGCAGATCAAGTCGCTGGAGTGAAGTGGACACGATTTCCCAAATTAAACAGCATCCTGAAAGGCTTGAGGCGTGGAGAGGTCACCGTATTTACTGGACCGACTGGAGCTGGCAAAACAACTTTGCTTAGTGAGATGTCGCTCGATTTGTGTATGCAAGGGGTGAACACGCTCTGGGGTAGTTTTGAGATTCGAAATGTACGGCTTGTCAAAATGATGCTCTGTCAGTACTCGGGGTTGAATTTGGAGAAGAACGTGGAGCAGTTTCAGTATTGGGCTGACAAGTTTGAAATGTTGCCAATGTATTTTATGTGTTTTTACGGAGCTCAGAACATCAATACTGTTATCGAGACCATGAGCCACGCCGCTTATGTTTATGATATAGATCACGTGATAGTTGACAACCTGCAGTTTATGACGTCATACCTGAGCCGTGGAGACGACAAATTTTTTGCGCAGAATCACGTAATTTCAGCTCTAAGGAATTTCGCAAGCTCGAAAAATGTGCACGTCACACTGGTTATACACCCAAGAAAGGAAAATGAAGAAGTCGAGCTGCAAACAGCGTCGATATTTGGTTCGGCCAAAGCAAGTCAAGAGGCGGATAATGTGATTATTTTGCAGAGCAAGAAAGGAACGGCACAAAAATATCTGCAGGTTACTAAGAATCGTTTTGACGGTGTCCTTGGTCGTGTTCCATTGGAGTTTGTCAGAGAATCTCTATCAATGTCAGGATTTGGCAAAGTTCTTCAGTCAAATAAATCAATGAACTTTGATAGGGGTCACCCCGCGAAGTTCAAACCAACAAGACATACCACTGATGGGGGCTTGGTAAAGTTTTCCGCACCAAAAATGATTGGCTCGAATAAAATCATTTCTAGAAACACGGCCACGACGCAACGTTCTTCGGAGAAGGAAAATACTGACAGCATTGCACGCCATTATGCCACTAATTCTACGTTAGACAGGCAGCGCGAAAAAGGAAGCCAGATGGACAGTGATGGGAAAATGGCAGATCATGATATCGATGCTGGAATTTCAGACGAAAAAAAAGAAAGCGTACAAAGAACGGTGAAAAGAATTTTGAGCGGTACGCGGTTGATAACAAAAGCTGTCAATGGACCCCGAAATAATAACTTTAGGGCTAATATTGTAACTGACAGAAAACAAAACAAAAATTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q96RR1	Twinkle mtDNA helicase OS=Homo sapiens OX=9606 GN=TWNK PE=1 SV=1
Q5ZIW1	Twinkle mtDNA helicase OS=Gallus gallus OX=9031 GN=TWNK PE=2 SV=1
Q8CIW5	Twinkle mtDNA helicase OS=Mus musculus OX=10090 GN=Twnk PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005193 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13481 all species →	AAA_25	AAA domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR007694 all species →	Domain	DNA helicase, DnaB-like, C-terminal	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR027032 all species →	Family	Twinkle-like protein	Interproscan
IPR034154 all species →	Domain	Archaeal primase DnaG/twinkle-like, TOPRIM domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12873 all species →	T7-LIKE MITOCHONDRIAL DNA HELICASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003678 all species →	Molecular Function	DNA helicase activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0006260 all species →	Biological Process	DNA replication	Interproscan
GO:0003697 all species →	Molecular Function	single-stranded DNA binding	Interproscan
GO:0005739 all species →	Cellular Component	mitochondrion	Interproscan
GO:0006264 all species →	Biological Process	mitochondrial DNA replication	Interproscan
GO:0043139 all species →	Molecular Function	5'-3' DNA helicase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K17680	PEO1; twinkle protein	EC:5.6.2.3	Mitochondrial biogenesis	ko03029	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074638652.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

60TPM > 0

2Conditions

13.7Max TPM

4.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	32	3.90	13.68
all_coral_tissue · baseline	38	28	5.46	11.23

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	13.68
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	10.17
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.42
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.07
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	9.04
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	8.71
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	7.10
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.59
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.56
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.55
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.21
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.12
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	6.06
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.89
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.31
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.27
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.23
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.05
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.04
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.81
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.59
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.35
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.28
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.60
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.49
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.38
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.31
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.01
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.85
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.21
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.25
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.14
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	11.23
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.77
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	10.44
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.73
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.59
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.51
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.41
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	9.01
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.99
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.81
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.94
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.77
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.52
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.39
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.33
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.08
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.85
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.74
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.66
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.41
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.00
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.84
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.82
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.58
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.31
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.93
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.61
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	2.31
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.