Gene detail

Detailed information of XP_074639187.1 in Acropora palmata

Genomic Location: NC_133892.1:13083851...13093123
NR annotation: XP_029198762.2, uncharacterized protein LOC114963696 [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074639187.1

ATGGCGGCAGACGAAGAGATGAAGAAAGTTAATGAAAAGTTAAATTTTTTGTCGTCAAAGTTCGACCCGTTAACGGCTCTTTATAACAGAAAATTACAACCACCAGTGCCAAACATATACGTATTCAACAACCTTTCAGAATATACTAACGCAATCAGAGAAGGCAAGATAAAACCTAGCGAATATAAGCCTTCGGAAAGTCACTCTTCTTCTACAGAAGCTGCAAGTCGAACAAGAAACTTGAAACCAGAGTACAAGCAAGACAATAAAAAAAGACTAAAGGAGAGGCTTAAGGCCATGTCTGAATCGGTAGGGAATGGAGTTGGTGGTACAAATTTGGAGAAAAAGAGAGGAGGTAGAATCGATGATACAAAACTGAAGGAGTTACTTTTGGTAGAGGAGACCTTTAAAAGGAAACAAACGGCCAAAAAGCGTATGAACGTAATGCAAAAGATGGAAGCATATACAGAAGGACCCTATAGTTTATTGCTTAAATGCGTAACTGAGAGGCGAAGAGTGAGGGTATGGACCAGAAGATACAAGGGTCTGCGCAGTGTTCTTGCTGGATACCTTGTTGCTTTTGACAAGCATATGAACATGGCTCTTTTGGATGTGGATGAAGTATACACCATAGAGCAGAGAATTAATCAAGATGCCAGTGGAGTATCCCCTTCCTCCAAAAATACCGAAAAAAGGAAAAAGAAAAAGAAGTCGGTACTAGAGAATGAACTGCCTTGTGAATTAGCTGGCACTGCTGAAATATCATTGCCTACATCTGCATCAGATACTGAAGAGCTTGATTTGTGTACTAAGGAAGGAAATAGAGAAAGAAGCTCAGAAAGAAACTCTCCCAAGGAATTTCTTCCACTCCAACCAATCACAAGTAATCAGTCGAGCAAAGAAAGTGTGAGTACATGCAAAGAGAAGCATTGTCAAATTAGCGCTTCTGACAACGAAGTTGCGGCGAATTCAGACTGTGCTTCAATAATTGATCTCCCTTTGAGTGGCAATGAATCAATGTTACCATCTGCTCAGTCTTTGAGTATCGCTTTGCGAGCTTCTGTGAGTGGTTTGGATGACGACTTCCTAAAGCTAACTGAAGTAACACTCACTGAAGCAGTTTTAGAGAATGCTGCGGAACTTGAAACAGTGATGGGTCAAAATGATAGCAGTCTGCCTACTAGAGAGGAAAACTGTGCCTTGAACATATCTTGGAACGACAAGTTAATCGAAAAGATGAAGAAAGACAAAGACGAAAGTAATAAATTAGCGAATACGGAAACTTTTGATAACAAGGAAAGCGGAGAAACTGGGGATGTAAGGGACTTAAGTTCATGCTCTTTTAGTAATAATGATAGTGGAGTTGTGTCTAATGCAATACTTAACAACAACACAAAACAAGGGCAAGGTCTTCGGTTGCGAACAAAGGGATCGTGTTTACCTCCTAATGGCATGGAACTGTTGAGAGATAACGGAATAGCTGATTATCATACTACCATGCCAATCGAGAATTCTCAGCAGTTGACGGCGATAGGAAAGGAAGACAAGTTAATCAAAATTCCAGACACAGGACGCTTAAGGAATTCAGAACACGACGTTCATGAAAAAAACTTACTCCAAATGGAAGCTGAAACGCATAAGATCGACATCAAAGACCTCTGCGACCTCCGTGAAAATTGTTTGAATAAAAAAGATTTAGTAGTTTGCTGTTCCAAAAAGGACGATTCTTCAAACAGTGATATCGTTACTTTTCTTCGAAGTTCCTCAATTGTTTCAACTGAAGCAGTTGCTTCATTTTCAACAAAAGGAGAAACAGTAATGCAACGTGCAGAAGCCCAATTAAATGAAAGAGCTGCTAATAAATCTTGCAAGGACGCTAATCTTGCCCATTGCTTGGTATTTTATGACTTTATCCGCTCTGAGACACCGTTATGTAAAGATCCAGTGAGTAGTGAATCTCGTTTTGCCTTGTGTTCGGAGACTGCCAATGCCATTCCTAACGAAGTAAGACAAGAACCTGGCAGCCCATCAAGACCGAGAAGTGATACACCATCCATCGATGCACCTTTCTCTGAGGTTGTTTCCAATACGGAAGAGGATTCAACATCAAGGTACCACGAAGGGAAAGGAGACAAATGTTTTTTTCACAAGAAAGACCAACATGATTTGGCACTTAAATCAAGTGCGACCGTGCTGCAAGAAGGTGAACTTCAAGAAGATTATCACTCAATAACTCAAGTTACACAGATGTTTTCGAAGCCAAAGGAAGACGGAGCTTCTGCCAAACTCGAAGACCTGGAGAAAGTACCCCATGATGCTTTGAAACATGAAAACAGTGGTCAAGACATTCTGGAGAATTCAAAGACCGCCGCCTCATTTTCGTCCGAGACAAATTCGCCATTCCGTAACTTGCTGAGCATGACAGGAAAAATCGCTGATGCACAAGCTTCCTCGCATTCGTTTCGCAAAGGGGTAAACGTCAATCCAGGGCAGAAAGAAGCACACAACGAAACGTCTTCCATGAAAGGTGACGAGAAGAATTGCCAAAGCCTCAAGACTGAGGTAGGAATTGGAGAAAAAAGGACCTACAAAAAAACATATAAAAACGATGACAACTCCGATAAGGCCACAGAATATAATCCGCATAAAGAAGAAGGCGAGATAAGTTCTGTAAAGGATGATGGTTTACCGCCGAATGAAAAATCGAAAAACGAAGAAAAAGAAGAAGGAGAGCTATCTTCATCTGATTCAGATGATGATTCATCGCTTGTAAAACATTGTGATACTAACGATGGTAAAGGTGTACAAAGTGACAATAGATTGAAGGACGAAAACAAGCAGGCTCGTCCACGCGCGCGAACTGATTCGTCAAGGGATTTTCCCGACAAATTCCTCGATGACAGATCAAATTCTAGAAGAGAATATCCTTCTCATTCTGTACAAAATGCTGGTCTTCGAAGGAAGCTGCGTGGATCTCGAAAAAAGGTATTACCATCAACAAAAGTTAACAGTTCAAAGGAGACAAGTAACCGTGTTCGTAATAGATCGAGATCTGACATGGCTGCCAAAAAGAACAACTGTGTAGAAAAGCATAATCGGGATGAACTGCTAACTGAAGAACAAAAACATGGGAAAGCACAAAGCACTGGAACCAAGGATGAGCGAAGGAGTTTCATTCATTCTGCTCACGGAAAAGAATGTAAAACGAAAGAAAAAGGGAAGTTTCTTGACAAGCAAAATGAAAAGCCAAGCAATTCTTCCCAGGACGCGGAAACGATAAAGAAAAGAAGCGAATCGAAGAGTGAGATTAAAAATCGCAGCAACATACCATGCCCACCTGAGACCGACAAGATAGTTCCAAATAAGTTTGAACTTCACCAGTTGAGCACGAAGGACAAGGAAACAAAGAAATTAAGAACTCCTGAAGATGCGACGGTCGATAAAGACTTTAAGGAAGAAACACAACTTTCAAAAACAGTAACACGCACAAGAGCAAAGACAACTTTGCATCATCAAATTGTAAAAACAGGAACGAAATCAGCTAGACCTTTGAGCAGACAGTCTGAAGAGACATTAATGAGGAGACCTTTGTCAGTAGACAATTTTGGCAGTAGAAAACATGTTTCGGAGAATAGGCAGGGAAGCACAATCTCACATAGAACGCACTGTCTAGAGCAAAGCAAAACTAAAAGGAAAGATGAGGCAAAAACTACTACAACTGATATTGGAAAATGGGATATTTCAGGCAAAAGGAAAACGACTCCGTCAAAGACTGCACCGACGGTTACTACAAGAAACACACCAAAGAAATCCCCTAGTGCAAATAAAAGAAGGACAAAGCCTCAAAACAGTAGTCATAATCCATTGGAGAATCCCAGGAAACGGATAAGGCCCACAGAGAGCACAGAGAAAAGGAAAAGCAAAAAATCCCGGGTTGACGAGCAAAGAAATTCTCGCACAGCTGACACTATAGAGCCCAACATGTCAACGGCAATTGCCCAATGTAACGATGTGAAAAACAGTGAATCGTTTTGCATCAAAGTGAAAGACTCAGCAAATCAAATGAACCCGGACAAACTCGAGTATTTTCAACTCAATAAAACTGAACATAAATGCCAGAATAGTCCCGCCATAAAATCAGTTGCATCACGGGCAAAACCAATTTTGTTTGGTCGAAATAAGTTTTTGGTGTTTAAGCGACGTCATGTCAATCAGTTGTTTATAAGAGGAGACAATGTTGCCATGATAGCTTATGCTGAATGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q7T076	U7 snRNA-associated Sm-like protein LSm11 OS=Xenopus laevis OX=8355 GN=lsm11 PE=2 SV=1
Q54HH8	Small nuclear ribonucleoprotein Sm D-like protein OS=Dictyostelium discoideum OX=44689 GN=DDB_G0289453 PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0007761 (this species only)

Pfam domain

No Pfam domain signature was detected for XP_074639187.1. This gene does have a gene model — the search simply returned no hit.

InterPro

InterPro term	Type	Description	Source
IPR010920 all species →	Homologous_superfamily	LSM domain superfamily	Interproscan
IPR039267 all species →	Family	U7 snRNA-associated Sm-like protein Lsm11	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR21415 all species →	U7 SNRNA-ASSOCIATED SM-LIKE PROTEIN LSM11	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005683 all species →	Cellular Component	U7 snRNP	Interproscan
GO:0006398 all species →	Biological Process	mRNA 3'-end processing by stem-loop binding and cleavage	Interproscan
GO:0071209 all species →	Molecular Function	U7 snRNA binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for XP_074639187.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074639187.1 across 84 RNA-seq samples of Acropora palmata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

52TPM > 0

2Conditions

11.0Max TPM

2.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	26	2.08	11.02
all_coral_tissue · baseline	38	26	3.42	8.94

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	11.02
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	5.69
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.96
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.81
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.71
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.61
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.61
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.60
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.24
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.14
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	4.00
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.53
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.38
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.26
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.20
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	3.11
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.83
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.69
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.45
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.32
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.21
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	2.19
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.99
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.91
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.78
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	1.40
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781	0.00
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.94
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	8.43
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	7.18
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.58
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	6.18
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.85
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.74
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.28
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.28
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	5.14
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.99
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.74
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.73
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.68
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.61
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.59
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.23
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	4.00
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.99
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.82
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.72
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.69
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.68
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.67
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	3.47
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	2.74
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781	0.00

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.