Gene detail

Detailed information of XP_074639239.1 in Acropora palmata

Genomic Location: NC_133892.1:14500710...14529332
NR annotation: XP_029210432.2, LOW QUALITY PROTEIN: DNA-binding protein D-ETS-4-like [Acropora millepora]
Species Acropora palmata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

XP_074639239.1

ATGAACTTCGAGGAGACGCCAGTATGGTCATTTGGTTTCTTGGGGAATTCTATGCTTTCTTCAAACGAACTTCAAGTTCCCACGGAAACAGACATAAGCCAAGTTGTCCCCGATCTTACTGCTGGCGTAACCAGCAGTGATGTGGACATGGAGGCGACACTGGGAAGAGGCTTACTGAATTCTTTCAACTCGGATTACTCACATGAAGAAGATCTTCAAAGGGAGAAAAGAAGTAGCCTCAGTTCTTGGAAGAGTTGCTCCAGTTTTACATCAGGCTATTTTTCAGATGATAACGAGACTAGGTCTCCAGTCTTTCTCCTGGAAGATGACCACACCTTGTCCCCAGATCGCACCTTGCTTGATTTGGACAATGTGTCTCCTAATGTGTTGGAGGTACTTGGTCCGACAGGAGAGGAGGAAGATGCGGGTTCCGATTGGATGACATGCTCTCCGTTTACTTGGACAAAGGCTCAAGTTCAGAGCTGGCTTCGTTGGGCGTGGCAACATTATAACATCCCGGGAGAGTATGATCCCCAAAAATTGGACCTTACCGGTCCAGAACTGTGTGTGTTTACTCTAGAAGAATTGAAAAGTCGTTCAGAACACGGAGGTCTTCTGTATGAAGCCTTCACAGCGTTGGACATTTCCCCGTGGAAATGGATTAGTACCTTCTATGAAGGAGCAGGGGACTTGTCAAGTGACCTGGACCTCGATAATTTGCTTGCTGTGCAAGAGTTTTGCGGATTACCCAATCGCGATCCCATTGACTCGAACTCTGAAGAAAATGGAGAATCTCCCTTGCCAGAAAGGGACGAGTCGATTGATAGTGATAGTGGCGAAGAAGACACCCCTGTGACAATTGACTCAGCAAGTGATTCTCCTACTTCTTCCAAGGATTGCGTGACATCCTCTAGTTTTCCTAATCAAGTCACCAGGCCCCATCTCACATTGTCGCAGAATTTCGGCAGATTTTCATCTCGACCTTCAGCACATCAAAGTCCTGTTGCCAATGGTATTTGTGCTTCCCGCCTGTGGCCGCCAAATGGAAGTTTTCCGCCTTGTGTTCCTCCACCGATTAACGGATTTCCCCATCCACGTCCAATACCGCGTACCCTCCCGGAGTTACAGCGCAACCGCGAACTCCCGCCCGTTCCCCCGCTTATCAAGTCCCCTAATCTGCCCTCTCCTACAAGTCCGTTGGAAAACTTTCCTCGGACGCCTCTCCAGACGCTGTCATTTGCTGCTAGTTTGTTTGCAAAGAGTGAAAACATGTTTGAAAGTTCACCGTCAAAGAAAACTTCTGGCGAGGAACGCGTGACGCGGGGTGGCCTGTATGACGAACCGTTCTCTGCTGGTGTTCCTATGGAAAACGGATTCATGCCACCCGATGCCAAAAAGGCCAAACTGGAACTTGGTCCCCCTGCACTACACACCAAACTCCCAGTGAATGGTGCCCCTCCACCCTTGAGATCCTCAACTACCGAAACTCAAGTTCCATACCCTGGGAATCTGTCCCCGACTTCTTGTCCCGACAGTGATATAGATAAAGAAGAGCGAATGTCACCCTCACCACCTGCGTCTCCCGCTGTAAATGGGGCTGCACACAAAGGCTGCTACCCTGCAATGACGAGAAGGAGAAATAGCTCGAGCTCAACTGACTCAGGCACGGAAGACGCAAAAGATAGTAATCAAGGCGGTTACTCCGTTCAGGGGTCTTCATCACCAAGTGTGAAGCCGCGTGCCGGCAGGAGAAAGCAGACAAGATCGTTGCATTTGTGGGAATTCCTCAAAGAGCTTCTGGAGAACAAGGAAACGTGCCCGCGATATATTACGTGGATAGAGCGCGAGGAGGGAATCTTTCGGCTCGTGAATTCAGGCGCGGTGGCCAAGCTGTGGGGTCAGCGGAAAAACCGGCGTAACATGAATTACGAGAAGATGAGTCGAGCTTTGCGCTACTATTACGAAAGAAAGATACTTGAGCGAGTACCTGGTCAACGGCTGATTTACAAATTTGCTCCGGACACCATGAAGGAGTGTAACTTCAGCTTCATGAAGAAAGATGGTTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q15723	ETS-related transcription factor Elf-2 OS=Homo sapiens OX=9606 GN=ELF2 PE=1 SV=2
Q9JHC9	ETS-related transcription factor Elf-2 OS=Mus musculus OX=10090 GN=Elf2 PE=1 SV=1
Q99607	ETS-related transcription factor Elf-4 OS=Homo sapiens OX=9606 GN=ELF4 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003073 (this species only)
Transcription factor family	ETS · all TF in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00178 all species →	Ets	Ets-domain	Domain	Interproscan
PF02198 all species →	SAM_PNT	Sterile alpha motif (SAM)/Pointed domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR013761 all species →	Homologous_superfamily	Sterile alpha motif/pointed domain superfamily	Interproscan
IPR003118 all species →	Domain	Pointed domain	Interproscan
IPR000418 all species →	Domain	Ets domain	Interproscan
IPR046328 all species →	Family	ETS family	Interproscan
IPR036388 all species →	Homologous_superfamily	Winged helix-like DNA-binding domain superfamily	Interproscan
IPR036390 all species →	Homologous_superfamily	Winged helix DNA-binding domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11849 all species →	ETS	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0043565 all species →	Molecular Function	sequence-specific DNA binding	Interproscan
GO:0003700 all species →	Molecular Function	DNA-binding transcription factor activity	Interproscan
GO:0006355 all species →	Biological Process	regulation of DNA-templated transcription	Interproscan
GO:0000981 all species →	Molecular Function	DNA-binding transcription factor activity, RNA polymerase II-specific	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006357 all species →	Biological Process	regulation of transcription by RNA polymerase II	Interproscan
GO:0030154 all species →	Biological Process	cell differentiation	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for XP_074639239.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of XP_074639239.1 across 84 RNA-seq samples of Acropora palmata. This gene has no row in the species' RNA-seq expression matrix, so every value below is shown as zero — the matrix simply does not cover this transcript. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

84Samples

0TPM > 0

2Conditions

0.0Max TPM

0.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
all_coral_tissue · exposed	46	0	0.00	0.00
all_coral_tissue · baseline	38	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study
SRR8800026	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800027	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800028	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800029	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800033	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800034	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800036	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800038	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800039	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800040	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800042	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800044	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800045	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800047	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800051	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800053	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800056	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800058	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800060	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800061	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800062	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800063	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800065	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800066	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800068	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800071	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800073	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800075	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800077	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800079	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800080	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800083	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800086	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800087	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800088	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800089	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800091	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800092	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800093	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800094	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800095	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800097	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800099	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800100	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800105	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800107	all_coral_tissue · exposed	all_coral_tissue	not recorded	exposed	SRP189781
SRR8800030	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800031	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800032	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800035	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800037	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800041	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800043	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800046	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800048	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800049	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800050	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800052	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800054	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800055	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800057	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800059	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800064	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800067	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800069	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800070	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800072	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800074	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800076	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800078	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800081	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800082	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800084	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800085	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800090	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800096	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800098	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800101	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800102	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800103	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800104	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800106	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800108	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781
SRR8800109	all_coral_tissue · baseline	all_coral_tissue	not recorded	baseline	SRP189781

Source: CnidoSite RNA-seq expression matrices (APALM_TPM, StringTie quantification over 84 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.