Gene detail

Detailed information of acyt_s0012.g9.t1 in Acropora cytherea

Genomic Location: sc0000012_pilon:208506...216926
NR annotation: XP_015763223.1, PREDICTED: RILP-like protein 1 isoform X1 [Acropora digitifera]
Species Acropora cytherea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

acyt_s0012.g9.t1

CACGAATTATTTTGAAATTTCTAACCAGTTCAAAGCTGACCAGTTCTAACAGCCTCTGAGAGTGACGATTGCCTTCAACAGATCTGCAGAGAGTAATTGTGCGGACGTACGGATTATTTAGTGTTCCGTAACTGCGCGGCATTTTCTCAATTAGAAACGAAATATTTACGAACGAACGGGTTCAATTTAGAACCATGGCATCAGATTTAACGACTGCCGATATTTATGAAGATGCTTCTTTGATCGGACAAGACTTCGAAAAGATAATCGCAAGTTTCGGCCACGAAGCAGTCGTCGACTTGATGCCAAAAATCATTCGTGTCCTTGAGAAACTTGAGCTGGTCGTCGGGGAGAAAGAGAAAGCTAGACTCGAAATCGAAGAGCTGAAGCTGGAAAATGAGAGGCTTTACATGGAGATTACAAAGGAGGCCAGTCAGAGACGGCAGTTAGATGAGGAACTTTATCAGATTTCTGCAAGTGGAGAGACAGAGAACCTTAAAACAATGTTAGCGAAACTTCAAGAGGAGAATCGAAAATTAAGACTGGAGTACGAGGTCTTTGCAAACAATCAACCAGCAACGGCCTATATCAGCGCACCCGGCGACGCAGAGCTTATGGAAAAGATGAAGCAAGCAATTGACAACCAGAGGGATTCCATAAGGAGCAAAAACGCAGATATTGACAGTCTTAGGAATGACTTGGAAGCGATGGAAGAACAAATTCAGAGACTTACAACCATCAACGAAAGTGTGCGAAAAACCCTAGTCGCCAGTCAGGCACGTGTTAACACTTTAGCCAAAGAGAAGGCAGAGCTACAAACCGAGCTGCGCACACTCAGTCGAGGCACAAACGTGGTACAGCTACAGGGGAACTACCTAGACGCCGTTGATGATGCAGATCCCGAACGAGCTAACCTTGAACAACAACAACAAGTAAGCACCGAAGAGAACGGGGAAAATGTGTACGGTAGAAACCATGAATTACAACATCTAAAGCGTGTAGAAAACGCGGAAGCTGTATGCCTTACAGATCGTGCTACACCACAGCTGGAAGCAGTTGAAAGCGGACAGGATGTGGATGATAGAGGTGAGCTGCAAGAACTGAACACCACAAAGAACGCGGAAGATGAGGGGGTTGAAAATGAAAAAGGGCAGGGTACGAGCGACAAAACGTCCCAAACGATATTGAAGGACGACAAAAGCGAAGTGCCTCCGCCAAAACCACCAAGACTCCAAATAGAACTTGATGACGAAAAAGGCGGCAACGATTTGTGGCCCAGCAACGAGGGCCGCGTCGTTAGCGATCAAGAAAAACGTCACACTGAGGAGGATTCAATTGATAATACGTCTATTGAAAAAGACGAACATGCAGATTGGGAATTTATTCGTGTGGCGCCGAAAGTGAAGTCAAAATTAGAAAAATGGACAGAACAGAAAGAGAAGGCTGAAAGTAAACTAAGCAGCACAATGGTGAATGTCAAGGACCCAAATCGACCCCGATACACCAAAGCAGAAATGCTTGAGGTTTTAATCGAAAGGAACAATTTGAAGGAAAGGGTGTTTGCACTGGAAGATGAACTTCGCATCTACAAACCCAGCAGTTACGATGAGGATCTGGAAAATCAATCCACAAAACAAACGACTAAACCGAGGAGAATTTCCAGAAAAGAAGACTCAGGAATATCAAAAATTTTCAGTATCTTCAGCTACCACCGCGATTAGCATATAAAACTGTTTTGAGGAAGAAGTGGCTGCCAGTCCGCGAAGAGGAATGACACGAGGCAAGCACACAAAGAAATGAAAGCCCACAGTTACTGGTCTTTTTGAATTCCCCGCTTCAGCTCAATACTCAGCTGTTTACAGCTCAATTGTCTACTGTTGACTAATGGCGTTTGCGTGGGGTTAGAGAGTACATATTGTGACAGGGAAATAAGGTTTATTGATTACGACTCTTCCAGAGCACCCCTGGCCAAATTGGTTTGTGTCATCCAAATTAGTATTGATTTCTTAATAAAATATCCACTTATCG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5EBL4	RILP-like protein 1 OS=Homo sapiens OX=9606 GN=RILPL1 PE=1 SV=1
Q17QG3	RILP-like protein 1 OS=Bos taurus OX=9913 GN=RILPL1 PE=2 SV=1
D3ZUQ0	RILP-like protein 1 OS=Rattus norvegicus OX=10116 GN=Rilpl1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0006546 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF11461 all species →	RILP	Rab interacting lysosomal protein	Family	Interproscan
PF09744 all species →	Jnk-SapK_ap_N	JNK_SAPK-associated protein-1	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR039911 all species →	Family	JNK-interacting protein 3/4	Interproscan
IPR034743 all species →	Domain	RH1 domain	Interproscan
IPR021563 all species →	Domain	Rab interacting lysosomal protein, dimerization domain	Interproscan
IPR019143 all species →	Domain	JNK/Rab-associated protein-1, N-terminal	Interproscan
IPR034744 all species →	Domain	RH2 domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR13886 all species →	JNK/SAPK-ASSOCIATED PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005078 all species →	Molecular Function	MAP-kinase scaffold activity	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0008432 all species →	Molecular Function	JUN kinase binding	Interproscan
GO:0016192 all species →	Biological Process	vesicle-mediated transport	Interproscan
GO:0019894 all species →	Molecular Function	kinesin binding	Interproscan
GO:0030159 all species →	Molecular Function	signaling receptor complex adaptor activity	Interproscan
GO:0046983 all species →	Molecular Function	protein dimerization activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K20173	RILPL1; RILP-like protein 1	-	Cilium and associated proteins	ko03037	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora cytherea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora cytherea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →