Gene detail

Detailed information of acyt_s0051.g25.t1 in Acropora cytherea

Genomic Location: sc0000051_pilon:241506...244169
NR annotation: XP_029188617.2, mothers against decapentaplegic homolog 6-like [Acropora millepora]
Species Acropora cytherea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

acyt_s0051.g25.t1

GCATGTGACAGGAATCAACCAATCAACATGTGTTTTTATTGCTGGTAGGTCAGTACTCAGTAATGTTGTGTGTGCTGTGGTTGAGAAAGAAGTAGTTGATGTCAATCTGCCGGATCTTACATGCTGTCTAGACGTTTCAGTTTTCGACGTGGTCAACAACCTTCGCTCCTTCCTTCGCATTTAGGACAACGCATTTCTCTTCAATCGGCTGGATGTGATCGCTAAGAACAAATGTTATATGTTCAAGTTGTTCCGATTTGCCTTAAGGAAACTGTCCCTGCTCGAGAAATTCTCGGTTCTACCAGGCTGCAAGGATTTTTCGCCAGAGGAAAGTGCTGAACTCGAAGCGCTAACTCATTCGATCCTGAAGCGGTTAAAAGACAGTGACTTCGCCGCCTTGGTTCAGGCTCTGGAGACGCAAGGTGGTTGCGAAACGCCATGCATTTTCATTCATAGTCACGAGAGATTGGAGAAACGAGTGGCGGTCGAACCACATCTTGTTTTGTTCCGAATATTTCGCCTGCCGCAGATTAAAAGCTCGAGCGAACTCAAGCATAACGCTTCATGTTTGTCTAGTTATGGCCTGGACAAGAACGTCTGCATTAACCCGTACCATTACAGTGCTGTGATGTACACAGAACCCAGGAATGAGGTGTTTACAGTTCTACCAAATATAGTGGACGAGGAAAACGAAGAGAGTTCAGGATTCATAAGCAACCTTACGCAGTCAACAATCTGCCAATTGGATAGCAGAAGTTCTTATGCTCAACCTTCTTCGCAAACCACAGGAGCAGATAATGATTTTGCCGCTGGGAAAGAATTGCCAAAACATTGGTGTTCGATTGCGTATTGGGAACATAATGAAAGAATCGGACCAACTTATGAAGGGACATCGGATGTTGTTAATGTTTTTGACTGGTTACCTGAACCAAGCGGCTTCTGTCTGGCAGATCTTAACAGAAGTAGCGATGTGTCGGAGGGAACAAAACGCGTGCGGTCACAAATTGGCTACGGGCTGCAGCTTACCCGTGAGCGAGAGGAAATATGGATCTATAATCGGAGTAATTTTTCTCTATTTGCAAATGGTCCTACACTGACCTTCTCCAATGTAAACATTCCCGGTGGAAAATTGAGACACAATATTGTCGTGCATAAAGTTCCTCCGGGCTGTTCTCTTAAGGTTTTTGATTACAAGCTGACTCCTCAAGTATGTCGGGCGATAGACAGTGAAGGTGTTAGATGCTATCATCCCGAATCAATTAGAATAAGTTTTAAAAAAGGTTGGGGGTCGACAACGTCATCCAAAAAATACTGCCGACCGTTGGTAACATCTTGTCCCTGTTGGATCGAGATCCATCTATTCGTGTCGCGTTGATGCTCCCGTTCCGTGAGAACGGAGATGCGATAAGCGGGCAAGTGTAAAGTCTGCCTTCTTTTCCTGTCGAGTCACCGGTCGTGTTGAGTTGAGCATTCTGCAGAGTTAAAAGCCACACAAGTATAATAACAAAGATAGATTATATGATGTATATTGTATATAGAATATTGCTTGGACCAAAATATAATTTAAGCTGCCAAAAGATACGGACTTAGTCCAAGAACATTCCATATTTGGAAACCAAAAGTCGTAAGTAGATTTCTCTCCGTAGGAGAATTCAGCCCTTTGTACAGCCCCATTGTTGTATGATGTTGTTACGCGAGTGAAAATACAGTGGAAATGAATATATTATATTTTCAATGACAAGTCTTCTTTGAGGCTTTGCTCGAATCTCGGAATAATTTTAGCGTCCGGTGTGAGATAGGAGTTTAAAAATACACCATATTAATCAGCCCTCCGTCAAGAGCTCGAAGAAGAAATCTTAGTTGCTTTAACTATTGAAGTGTACGTCGATTTGCTTGAGTTTGTTTGCCTTGATGAAGCAAGGAAATAATTGAAGTCGCTTATCAGGATGATTAATGCATTGATCCTTTGAAGCTTGAAACAGCTAAACTTTTAATATATAAGTCCACAAAAACTCCCTTTGTATACGTTACAGCTGATAAATCAAAGGTCGTCATTCTATTTACGGTATGCGAAGTTGGAAATAGCTGAAGCGAGTCCAGTACTAGTTTGTTCAGCTGTCAATTTGGGAATCGTTCTTATAATAAAGTTGAAACTGAAGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9W734	Mothers against decapentaplegic homolog 6 OS=Gallus gallus OX=9031 GN=SMAD6 PE=2 SV=1
O35182	Mothers against decapentaplegic homolog 6 OS=Mus musculus OX=10090 GN=Smad6 PE=1 SV=1
O43541	Mothers against decapentaplegic homolog 6 OS=Homo sapiens OX=9606 GN=SMAD6 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0007814 (this species only) · gene tree & orthology
Transcription factor family	MH1 · all TF in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF03165 all species →	MH1	MH1 domain	Domain	Interproscan
PF03166 all species →	MH2	MH2 domain	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR013019 all species →	Domain	MAD homology, MH1	Interproscan
IPR001132 all species →	Domain	SMAD domain, Dwarfin-type	Interproscan
IPR008984 all species →	Homologous_superfamily	SMAD/FHA domain superfamily	Interproscan
IPR003619 all species →	Domain	MAD homology 1, Dwarfin-type	Interproscan
IPR017855 all species →	Homologous_superfamily	SMAD-like domain superfamily	Interproscan
IPR036578 all species →	Homologous_superfamily	SMAD MH1 domain superfamily	Interproscan
IPR013790 all species →	Family	Dwarfin	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR13703 all species →	SMAD	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005667 all species →	Cellular Component	transcription regulator complex	Interproscan
GO:0006355 all species →	Biological Process	regulation of DNA-templated transcription	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0006357 all species →	Biological Process	regulation of transcription by RNA polymerase II	Interproscan
GO:0007179 all species →	Biological Process	transforming growth factor beta receptor signaling pathway	Interproscan
GO:0009653 all species →	Biological Process	anatomical structure morphogenesis	Interproscan
GO:0030154 all species →	Biological Process	cell differentiation	Interproscan
GO:0060395 all species →	Biological Process	SMAD protein signal transduction	Interproscan
GO:0070411 all species →	Molecular Function	I-SMAD binding	Interproscan
GO:0071144 all species →	Cellular Component	heteromeric SMAD protein complex	Interproscan
GO:0140416 all species →	Molecular Function	transcription regulator inhibitor activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K04677	SMAD6; mothers against decapentaplegic homolog 6	-	TGF-beta signaling pathway	ko04350	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora cytherea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora cytherea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →