Gene detail

Detailed information of acyt_s0140.g10.t1 in Acropora cytherea

Genomic Location: sc0000140_pilon:260117...278395
NR annotation: XP_029200945.2, uncharacterized protein LOC114965432 [Acropora millepora]
Species Acropora cytherea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

acyt_s0140.g10.t1

TAACTACACGTTGTGCCATTTTTTCTTCCTCTTTGGGTCACGCAACGCCACTTGGTAATCTGTATATTGCGTGACAAGACGAAACTGAAAGGACGTGAGTCTGTTTGTAAAATGGCGTCGAAAAACGAAGAGCCGGAGTTACAGAAGGAGGGACATCGTTTTAACGTGAGGATTCCTGATTGGCCGTATGAAAAATGGAAATTAATAGAAAGCAACAAAGAAGACACCGACATCAAAGCTTCTCCAATGCACAAAATTCCAGTTGCGGTTGGTCCAGTGTTTGAATCATTACTCCAAAGTTTCTCTCCCCAACTGGAAATTCATAATGAACAAAAAAGTTTGCAAATATTGCATGAAATAACAATCATGTTGAAAGACAGCTTACACGAGCTTGGAAAGTCTTACAAATGCTTCGAAGAATATCGACTCGTTCAAGCCGGAAGTGTAGCTGAGAAAACGAAAATAGCGGCATTTGATGAGTTTGACTTTCTGATTGTCTTGGACTATTTTGCCAACCCGGAATACTTTCAAACGGTTGTCATGATGGATTTCGTTAGGATATACGTAAAGGACTCAACTATTGCAGATCTACTCCCGACTGAATGCAAGCTTCATTCAGGGACGATTCATTTCCTCGATTTTTCTCTGCGTTCAAAGTTTATGCAAATGTTTATTAAGATATTTGATTCGCGATTGCTACCTGGTTGGAAACGTGCCACTACTGACGAGGAAATAATTTGTGGTTCTGGTATAGCTTCAACACTGCATTTGACGTGTGACAAGTTCTGCTTAGACGTAGACGTTGACTTGTGCTCGTGCGTGCCCATAAGGGCTGATGATTTTAAAGGGGCTTTGTCCATTCCAAATGATGCAAATCCACATCTCAACGACTTCCGTTCTATTCAAGCGTTGTTGTTTGGATACATTAGCAACATCATGGAGCTATCACCTCTAGAATTGTATGCAATTCTTGGTAACAAAGATCCTGCCTTTCAAGCCATTTCTTCAAGAATCACTGCTCCTCATCTAGAGCTGTCTCCCTTCCAGTCTCTCTCACCAGAAGATGGGCGCATAAAAACCTACTGCATTGCAAAATGCATTATGTCAGCTTTCCTTCCAAAACTGAGTAAAATCTTTGGATGCAAAAGATGCTGCCATCGGCTTGTAAGATCTTACCACATTAAAAACATACTCCTGTTTATGCTCAAGAATTACAAAGAAGACTCGCATTGGTCAAACAGCATGGTTCCAGTTCGAGTGTTAGAAATCTTTTTTATACTGAAGGAATGCATGATTTCTAATGACGAATCATGTTACGACGCCGCTGTTTCTAAGCACTGCTTTCCTGGAACTCTTTATGTAGAAAATGTTACAAATTTAAGTCCATATTATAATTCTGAAGAGTTGGCGCTTGCAGACAAAGCTATTCCCTGTGATAGCTGTCTTACGAGGGTAGCCCTTATTGTGCTTGGTTTTATGGGCCAACTTGCTCAATTGTATGCTGCAGCTAACCTTCGGAGTCTCCCCGGTCCGAGACCTAACTGGTTATTTGGAAACGCTTTGCAACTATCACCTGAGCCTGATGAATTGCACACACAAATCCTGGGATTTGCAAATCAATATCGCAACCAGGGAATGTTTTGCCTCTGGTGTGGAGCTCATCCTGTTGTCGTCCTGTTTAAACCAGAGCTGGTAGAGGACCTCTTACGCAGCTCCAGATATACAAAAAAGTCTCAAGAGTATGACTTCTTACGTCCCTGGATTGGCACAGGATTGTTAACCAGTAATGGAGCAAAATGGAAGGCAAGACGTTGCCTGATAACCCCAGCATTTCATTTTCAAGTTTTAAACCATTTTATAAAGGTGTTTGAAGAACAAGCTGTGATAATGATTTCACATTTAGAGAAGAGAGTCAACAAAGGCGTTTTTAACATAATGCCATGAATTTCTCATTGTGCTTTGGATATTATATGCGTGACGTCAATGGGTTCTTCACCGAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9VA27	Cytochrome P450 4c3 OS=Drosophila melanogaster OX=7227 GN=Cyp4c3 PE=2 SV=1
A2RRT9	Cytochrome P450 4V2 OS=Rattus norvegicus OX=10116 GN=Cyp4v2 PE=2 SV=1
Q9DBW0	Cytochrome P450 4V2 OS=Mus musculus OX=10090 GN=Cyp4v2 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0011884 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF20266 all species →	Mab-21_C	Mab-21 protein HhH/H2TH-like domain	Domain	Interproscan
PF00067 all species →	p450	Cytochrome P450	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036396 all species →	Homologous_superfamily	Cytochrome P450 superfamily	Interproscan
IPR046906 all species →	Domain	Mab-21-like, HhH/H2TH-like domain	Interproscan
IPR050196 all species →	Family	Cytochrome P450 Monooxygenases	Interproscan
IPR001128 all species →	Family	Cytochrome P450	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24291 all species →	CYTOCHROME P450 FAMILY 4	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004497 all species →	Molecular Function	monooxygenase activity	Interproscan
GO:0005506 all species →	Molecular Function	iron ion binding	Interproscan
GO:0016705 all species →	Molecular Function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen	Interproscan
GO:0020037 all species →	Molecular Function	heme binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for acyt_s0140.g10.t1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora cytherea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora cytherea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →