Gene detail

Detailed information of aech_s0012.g185.t1 in Acropora echinata

Genomic Location: sc0000012_pilon:4256710...4261589
NR annotation: XP_029208093.1, cell division cycle protein 20 homolog [Acropora millepora]
Species Acropora echinata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

aech_s0012.g185.t1

CTCGAGCTGTAAAGAAAGGAAAATATATTCCGGCGTTCTTTGTTTCTGAAGCAAATTTATTCACTTTTGCGGAAAAGAATGTCGCATTTTCACTTTGAAACTGAAGTGAACGATCTCTTGAGACTCGATGGGCCGATGAATAAAGGACCCGCTCCTCGATGGCAGAGAAAATCAACCGAACCTCGATGTTCCACTACCTCTACGTCGACTACGCCGCTTCGTAGTTCATCGAGACTCAACTGCAGTAAGACGCCTTCAAAGACGCCTAAATCATTGAAGAAAACGCCAGGAAAAGCCAAGACGCCATCCGAAGACAGGTTTATACCGAATCGGAGTGCTATGAACTTCGAGATGAATTATCACAAGATGATATCAGCTGATCGCGAGAATGACGAAAACGACTGCTTGAGTCCTTCTAAAGCGGAGTTCAAAAAGAAAATGGCACAGAATATGGGTTTAAATGATGCAAATTCCAGGATTCTTGCGTTCAAAATGAAGGCACCAACACCAAGAGAAGGCCATCTGAATGATCTTCGAGTGCTTTACAGCAACAACAAAACCCCTTCGACATCGACAAAGAAAAATTCCAGACATATTTCTCCAGTTCCAGAGAGAATTCTTGATGCACCTGATCTCATTGATGATTACTATCTGAACCTGTTGGACTGGAGCTGTAACAACCATCTTGCTGTAGCACTGGGTGGTTTTGTTTACTTGTGGAATGCTGCTACAGGTAATATTGTCCAACTCTGTCAGACGTCAACTCCTGAGTGTTATGTTGGCTCTTTGGCTTGGATCAAAGAAGGAAACTATATTGCTCTAGGTGACAGTGATGGAGTTGTACAGTTATGGGATGTAGAAGCTCAGAAGCGCTTACGGAGCATGACAGGGCATTCCTCTCGTGTAGGTTGCCTTTCATGGAACTCTTACATTCTATCCAGTGGATGCAGAAGTGGTGCAATACACCACCATGACGTACGCGTGGCTCATCACCATGTTGCTACATTGGCCAGACACTCTCAGGAAGTGTGTGGGTTGAAGTGGTCTCCTGATGGAAAATTCCTTGCTAGTGGTGGAAATGATAACTTGTTGTTAGTTTGGGATGCCAGCATCAATACAATTAGTAACAGCAATACACCTCTTCATACTCTTAATCAACACCAAGCAGCAGTCAAGGCACTAGATTGGTGTCCATTTCAACGCAATGTACTGGCAAGTGGAGGAGGAACTGCTGATCGTCACATTAGGTTTTGGAATGTTAGTACAGGAAATTGTCTCAACAGCATTGACACTCATTCCCAGGTTTGCTCCATTTTATGGTCCAATGAATATAAAGAATTAGTGTCCAGTCATGGGTACGCACAAAATCAACTGACAGTCTGGAAATACCCATCAATGGTCAAAGTGACAGAATTAACTGGGCACACCTGCCGAGTTCTGCACATGGCAATGAGTCCAGACGGACAGACAGTGGTGTCAGCCGCAGCAGATGAGACACTGAGACTGTGGAAGTGTTTTGCTAGTGATCCTGTTAAAAAGAAATCAAAGCCTAATCCCACAAGTAGTTCATTAGTACATCGTGGTATACGGTAAAATATTGATATAAAGTAAATTTACATTAGGATAAAAAAGGTGGGTGTTAGGTATGGAGTAAAAGGACAGTTTGTAATGATGGAATAACAAGGCTGTTTTAGAGTCCACTGGACAACAAGAAAAATGAGTCCAAAGGTTTTTGTTGTTGTTTTTTTCTCTCCCCCACTCCCTTCCTTTAAGAACTTGAGAATACTCTAGATGACTGAATCTAATTATTATTCTTCCACTGCGTCAGTAAAATTATGCCAACAATGGGTGGGCGGTTTCTACTGAAATAGTCTTTTATCTGGGAAACACCGGTCATATCAGGAAGAAATAGAACTTTGCAGTTTGAGTTCCTTTGAGTTTTAATATTATTGATAGTTAAATCAATGAATCCTCATTAGGGTTTTAAAGTTTATGAAGCTTTTTGAAGAGGTCTTTACATTGGTTGCATTTGTCAAAGAAATCAGAATATATACATAACCAACACTATTGTCTTGAAAAAGATACAAGAATTGAATGTGCTGTAATGTTACAACAAATTAAAACATCTTTGTGTACATTTTCCCCTCTTGGGATTATCAATCTTACACATGCACCTGCTGTACGAAAAATGCAGATTCTTCCCAATAAAACCCTCTAATTTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q62623	Cell division cycle protein 20 homolog OS=Rattus norvegicus OX=10116 GN=Cdc20 PE=1 SV=2
Q9JJ66	Cell division cycle protein 20 homolog OS=Mus musculus OX=10090 GN=Cdc20 PE=1 SV=2
Q12834	Cell division cycle protein 20 homolog OS=Homo sapiens OX=9606 GN=CDC20 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001230 (this species only) · gene tree & orthology
Ubiquitin family	UBD\|Other\|Beta-prp · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 adaptor Cullin RING\|CDC20 · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 adaptor Cullin RING\|DWD · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF12894 all species →	ANAPC4_WD40	Anaphase-promoting complex subunit 4 WD40 domain	Repeat	Interproscan
PF00400 all species →	WD40	WD domain, G-beta repeat	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR033010 all species →	Family	WD repeat Cdc20/Fizzy	Interproscan
IPR001680 all species →	Repeat	WD40 repeat	Interproscan
IPR019775 all species →	Conserved_site	WD40 repeat, conserved site	Interproscan
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan
IPR024977 all species →	Domain	Anaphase-promoting complex subunit 4-like, WD40 domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR19918 all species →	CELL DIVISION CYCLE 20 CDC20 FIZZY -RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005680 all species →	Cellular Component	anaphase-promoting complex	Interproscan
GO:0010997 all species →	Molecular Function	anaphase-promoting complex binding	Interproscan
GO:0031145 all species →	Biological Process	anaphase-promoting complex-dependent catabolic process	Interproscan
GO:0097027 all species →	Molecular Function	ubiquitin-protein transferase activator activity	Interproscan
GO:1904668 all species →	Biological Process	positive regulation of ubiquitin protein ligase activity	Interproscan
GO:1905786 all species →	Biological Process	positive regulation of anaphase-promoting complex-dependent catabolic process	Interproscan
GO:1990757 all species →	Molecular Function	ubiquitin ligase activator activity	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for aech_s0012.g185.t1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora echinata tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora echinata, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →