Gene detail

Detailed information of aflo_s0027.g44.t1 in Acropora florida

Genomic Location: sc0000027_pilon:949197...972756
NR annotation: XP_015778856.1, PREDICTED: LOW QUALITY PROTEIN: adenylate cyclase type 5-like [Acropora digitifera]
Species Acropora florida · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

aflo_s0027.g44.t1

CTCTTGGAATCATTTCAATGAAACACATTACTTTTGTTAACGTAAGTTGGTTGAAGCAGACGCCAACAAATGAGAACGAGAACACGATCGTCATCCATTGGAACTGAACAGGACCAGACCTAAAACCAAGTGAAGTTCCCCGCTGAAAGAAGTGAAGACTTTCTTTTGGATTCCTATTCACAGTACTGACCCAGTTTAAAATTGTGCTTGAAGGTCTTCGACACCATCCAAGCGAGCTTGGGAGGAACCTGACGAAAAAACGCCTACAAACGTTTCGACAAATGACCTAAACAAAAATGTAAAAGACCACAATAAGGCTGCAAGTCCCAGAAGAACTGCCAACAACGGAGAAAAGATGGCATCGAGTATGGAAAACAACGGATCGACCGAAGTTCGACTTCGCTCAGTAGAAGTTGGTGTTGGGGATAACAACATCCGAACCATCAAGAATGAAATATCCCAAAAAGATAGCGCGACTAATGGATTTCCCGAGGTTAGCATTAAAAATGGAAAAACTTCAGAAGTAAAGGACGCTGAGGCCTTGAAGAATGATAATATCTGCGAGGATTCGTGTTGCGGCGATTGGACTTCATTTACGCGTGTTTTCAGATCACGGAGATTCGAGTCAGAAAAGCTCGAGGGCTTATATCAACGTTACGTGTTTCGCTTAAATCAGAAATTTATGAGCTGGCTTATTGGAATACTGCTTATTTTAACTTTTATTCTGATAGGGTTCCAATTCTCCATGGAAAAGACCGATAAACCAGAAACTGATGCCGAAGGCATCACTTTGATTATTTTTGCCTTCGCTTACATTTTACTGGCTCTGATAGTCAACAGAAGTGGTTCGTCTCAAAACCATTTAAACTGGGTATCTTACATTTTACTTGCCATCTCTTGTGGGTTTATTCTCGCTTCTGTAGTTTGTCCACCCTCAGATGTAGTGAAGCCGTCGGATTCAAATAGCCGTTATTCGCCTTCCGATGGTGTTTGGCTAACTACATTTTTTGTCTACATGACTTATACAATGTTGCCGGTTCGGATGCGGATTGCAGTGTTCGGAGGCTGTCTTCTTCCATCGGTACATCTTATTTCAAGTGCAGCCATGAATTACAAGGATACAAATCTTACAAGATTGCTTTTGGGAAACCTGTTTATATTTCTCTGTGCCAACATCACAGGAGTTTTCACGAAGTACCCAACAGAGATATCTCAGCGCCGAGCTTTTCTGGAAACAAGGAGATGCATAGAATCAAGGTTAACCATCATGAAAGAAAACCAGAATCAGGAGCGGCTTTTACTTTCTGTTCTACCACGATATGTTGCCATACAAATCAAAGATGATATAGAAAGTGGTATAAATGAAACTTTGCAGTTTCGCAAAATTTACATTCAGAGGCATGAAAATGTCAGTATTTTGTTTGCCGATATTGAAGGATTTACCATGCTTTCCTCTCAGTGTACAGCACAGAAGCTGGTTCAGTACCTTAATGAATTGTTTGCCAGTTTTGATACACTTGCTGTGGAAAACCACTGTTTACGCATCAAGATCCTGGGTGATTGTTATTACTGTGTATCTGGTTTACCAGAAGCACGTCCTGATCATGCACACTGCTGTATCGAGATGGGTCTGGAAATGATTGATGCCATTGCGAGTGTGCGAGAAGCTACTGGTGTCAACCTTAACATGAGGGTTGGAGTGCACATGGGCAAAGTTCACAGCGGAGTCCTGGGCCTTAAAAAATGGCAATATGATGTGTGGTCTGATGATGTTACAACTGCGAATCACATGGAGTCAGGAGGTCTTCCCGGGCGTGTACACATAACAAAGTCTGTCTTGAACTGTTTAAATGGTGATTATGAAGTAGAGGAAGGGCGTGGCCAGGAGCGAGATGCCTATCTCAAACAGTACAACATTCAGTCCTACCTGATAGTGGCAGAGCACCCAAGGAAGGTAAGACAGTGGAATTAATGAAGGTGTCTCCACTGATTACAAGAAAATTAACGGACTCAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q04400	Adenylate cyclase type 5 OS=Rattus norvegicus OX=10116 GN=Adcy5 PE=1 SV=2
P40144	Adenylate cyclase type 5 OS=Oryctolagus cuniculus OX=9986 GN=ADCY5 PE=1 SV=1
P84309	Adenylate cyclase type 5 OS=Mus musculus OX=10090 GN=Adcy5 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001378 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF16214 all species →	AC_N	Adenylyl cyclase N-terminal extracellular and transmembrane region	Family	Interproscan
PF00211 all species →	Guanylate_cyc	Adenylate and Guanylate cyclase catalytic domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR032628 all species →	Domain	Adenylate cyclase, N-terminal	Interproscan
IPR018297 all species →	Conserved_site	Adenylyl cyclase class-4/guanylyl cyclase, conserved site	Interproscan
IPR001054 all species →	Domain	Adenylyl cyclase class-3/4/guanylyl cyclase	Interproscan
IPR029787 all species →	Homologous_superfamily	Nucleotide cyclase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45627 all species →	ADENYLATE CYCLASE TYPE 1	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004016 all species →	Molecular Function	adenylate cyclase activity	Interproscan
GO:0005887 all species →	Cellular Component	plasma membrane	Interproscan
GO:0007189 all species →	Biological Process	adenylate cyclase-activating G protein-coupled receptor signaling pathway	Interproscan
GO:0009190 all species →	Biological Process	cyclic nucleotide biosynthetic process	Interproscan
GO:0016849 all species →	Molecular Function	phosphorus-oxygen lyase activity	Interproscan
GO:0035556 all species →	Biological Process	intracellular signal transduction	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for aflo_s0027.g44.t1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora florida tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora florida, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →