Gene detail

Detailed information of agem_s0001.g394.t1 in Acropora gemmifera

Genomic Location: sc0000001_pilon:6264555...6277483
NR annotation: XP_015767296.1, PREDICTED: leucine-rich repeats and immunoglobulin-like domains protein 1 [Acropora digitifera]
Species Acropora gemmifera · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

agem_s0001.g394.t1

GCAGTTCTCTATGGTTTAGCTATGGTCATATTACGGAAACCTGGCAAGAAACAAGCTGACGAAATTAAAATACGGTGCATTTGAAGGTCTGGGCCAGCTGGAAAACTTAGATCTCAGTGCAAACATGATCAGTTCTATAGAGGATGGTGCATTTCTGAGTCTATACCGTCTTAAAACATTATCTCTTGGTATAAACGAGATTTCAAAGATTGGTGCCCACCTATTTGCAGATGTATACTCTCTTACATCACTATATTTGTTCAAAAATCGGATATCGGTCATTGAGCCTGGTGCCTTCTCTCGGCTTATGGATCTCAGAGTTCTGTCGCTTTTCGACAATAAAATCCCCTCCATCCCTCAGAGGATGGTCAAAGGTCTGGAAAATCTCGAAGAACTCTACCTTCAACGAAACAGGATCAGTAAAATCGAACCATGGACTTTCTCGGCAACCAAAAAATTACAGAAACTGTACTTGTACTCCAACTTATTGACGTTTGTGCCTGAGAACATGTTTGAAGAACTCCGAACTCTTCGGGTCCTACATCTTGGTATCAATTTAATTGCTTACATAGCAGACAACGCATTTCGTGACCTCCACAACCTGAACGTTCTGTATCTTGATTCAAACCGCCTCACCATCTTAAACGCCAGGACGTTTTACGGCTTGATGAGACTCAAAGACTTACACTTGTTCTTCAACAATATACACTTCCTTGCCAAAGGGACTTTTGATCATCTGAAGAGTCTTTCCAGGCTCGTGTGGGATGTACCGGAAGCTTACCGCCAATCCATGCCTCCAACTGCAAAAAAGACGAAAGGGAGTAGGCTAAACTGTGACTGCAATGCTCGCTGGTTGAGGGACTGGTTGATTGAGAGGAAACTGGGAGATATCACTTGTGCCTTTCCTTCCAGTCTGTCGGGTGTATCAGTAACACAACTTGATGTCAGGCATTTTGTATGTGAAAAACTCAAGGCCTCACTTTATCCAAAGAAGACTGTAGTTCTCTTGGGCGAGAATGTTCAGCTTCGTTGCGAGACGAGCACCGGTGCAACGTACCACTGGATTCTAAACGGAACACGTCTGGAGTCAGATCAGTATCGAGTAATGAATCCCTTGGGAACACTGATAATCTATGGATTGGCAGAGGAGGACTTAGGGGAGTACGTTTGCGTTGCCGAAAGCGAGGCTGGGTTTTCAGCTAGTCATGCAATGGTTGATGCTGGAGTTCGCCCCTCATTCACTACCTATCCGGAGCCTGTAGACGCTAGGGAGCCACAAAAACCAGTTGTATTTCAGTGCAAGGCAAATGGATCACCCACACCCCTTATCAGGTGGTATAAAGACGGACTCTTGATTGTGGGTACTCCAGAGGAATCACGCTTTCACATCACCATTGAGGGGTCATTGATGTTCATGGGTAGGAGGTACCATATCACTAGGGAGGGATCTTTGGTGATTTTTGAACCTCGGGTTGAAGATGAGGGCACGTACAAATGCGAGGCCGAGAATGCACTTGGAAAAGTTTCCTATGAAGTCGGTCTTTATGTTGAAATGGGTGAGAAATGCGACAACGGCTGTAAGAGAGGCAGTGTATGCTCAGCAGTCAAATACGGTTGCCTCTGTTCGCGTGGATTCTACAAAAAGGATGGCCAGTGTATACAAGTCACGAACAAGAAAACCACTTCGACAAAAGACGAAACGGGTTCTGGCTCGGGATCAGGTTCGGATCAAGGATCCGGTTCAGGTGTGGGATCAGGGAAATCTGCTGACACGTCAGGCGATGAAAGAAATCCAACGGACCAAAGCGGAGCCGGCGTAGATCAAGAAGAGTCTGGTGACAAGTCCTCCTCAAACAAAGGACTCGAAAATAGTGACGGAGAGAGCGCAGATGGAACATTGGAGAGTTTGGAGTCAGGGAAAAAGCAGTCCAGACATCGAAGAGAGGCAGCAGCCGAGCTGGTATCTCCTTTAGAAACACCTCCGATGAAAGATCATGATTAGTTTTTCTTCCACCCAAAGAGAATTTACTCTAGCGCAATTTTAAACAATGTGAAATCGAAATACTTAATAATTATTAATGATGGGCTTTTGCCTAATGACAGAGTTCCAGTGATACTATATTGTTGGACTTTCAAACTTTTGTTAAGGTAAGATCAATAATTGCAACATTCTTGTGTTAAGTGCCCATAATCAAGAGGAAAAAATGGG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6P1C6	Leucine-rich repeats and immunoglobulin-like domains protein 3 OS=Mus musculus OX=10090 GN=Lrig3 PE=1 SV=1
Q8WZ42	Titin OS=Homo sapiens OX=9606 GN=TTN PE=1 SV=4
Q9I7U4	Titin OS=Drosophila melanogaster OX=7227 GN=sls PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0006444 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13927 all species →	Ig_3	Immunoglobulin domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR007110 all species →	Domain	Immunoglobulin-like domain	Interproscan
IPR036179 all species →	Homologous_superfamily	Immunoglobulin-like domain superfamily	Interproscan
IPR050958 all species →	Family	Cell Adhesion and Cytoskeletal Organization	Interproscan
IPR000483 all species →	Domain	Cysteine-rich flanking region, C-terminal	Interproscan
IPR003599 all species →	Domain	Immunoglobulin subtype	Interproscan
IPR032675 all species →	Homologous_superfamily	Leucine-rich repeat domain superfamily	Interproscan
IPR013783 all species →	Homologous_superfamily	Immunoglobulin-like fold	Interproscan
IPR003598 all species →	Domain	Immunoglobulin subtype 2	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45080 all species →	CONTACTIN 5	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0007156 all species →	Biological Process	homophilic cell adhesion via plasma membrane adhesion molecules	Interproscan
GO:0008046 all species →	Molecular Function	axon guidance receptor activity	Interproscan
GO:0030424 all species →	Cellular Component	axon	Interproscan
GO:0043025 all species →	Cellular Component	neuronal cell body	Interproscan
GO:0050808 all species →	Biological Process	synapse organization	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K17455	FSCN2; fascin2	-	Cytoskeleton proteins	ko04812	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of agem_s0001.g394.t1 across 48 RNA-seq samples of Acropora gemmifera. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

48Samples

3TPM > 0

1Conditions

54.1Max TPM

3.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
branch tip	48	3	3.04	54.06

Per sample · hover a bar for the full sample record

Show the sample table (48 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR3223317	branch tip	branch tip	not recorded	not recorded	SRP062488	54.06
SRR2169558	branch tip	branch tip	not recorded	not recorded	SRP062488	50.53
SRR3223319	branch tip	branch tip	not recorded	not recorded	SRP062488	41.40
SRR3169421	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169422	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169423	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169425	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169426	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169518	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169527	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169528	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169529	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169530	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169531	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169532	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169533	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169534	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169535	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169536	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169537	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169538	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169539	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169540	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169541	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182410	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182448	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182557	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182684	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182685	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182686	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182775	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182776	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182777	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182778	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182779	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182780	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182781	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182784	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182785	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182786	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182787	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182788	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182789	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182790	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182791	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182792	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182793	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182794	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00

Source: CnidoSite RNA-seq expression matrices (AGEMM_TPM, StringTie quantification over 48 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora gemmifera tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	9	agem_s0002.g203.t1	0.99999886085148
Negatively correlated	3	agem_s0028.g73.t1	-0.616309034699166

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora gemmifera, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →